\
| Variant ID: vg1008804375 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 8804375 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TCTGAAGTGAGCAACAGAAGAGGAGGCCGCTAGCCAAAAATGGGTCGGATTGGACCGGCCCCTGGTTCGGGCAAACCAGGGGTTCAGCTGAACCCATCCT[G/A]
GCGCCGTTAGATGGACGGTGTGGATTAGCCCCCAATGACGGTTGGAGGGTATTTTCGACCATTCCAACCGTCACAACCGTCATTGGGAGGCTATATAAGG
CCTTATATAGCCTCCCAATGACGGTTGTGACGGTTGGAATGGTCGAAAATACCCTCCAACCGTCATTGGGGGCTAATCCACACCGTCCATCTAACGGCGC[C/T]
AGGATGGGTTCAGCTGAACCCCTGGTTTGCCCGAACCAGGGGCCGGTCCAATCCGACCCATTTTTGGCTAGCGGCCTCCTCTTCTGTTGCTCACTTCAGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.80% | 1.00% | 2.18% | 0.00% | NA |
| All Indica | 2759 | 94.70% | 1.70% | 3.59% | 0.00% | NA |
| All Japonica | 1512 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 82.00% | 5.20% | 12.77% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.60% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.30% | 0.20% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 96.20% | 1.50% | 2.29% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.00% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 0.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1008804375 | G -> A | LOC_Os10g17470.1 | upstream_gene_variant ; 844.0bp to feature; MODIFIER | silent_mutation | Average:48.739; most accessible tissue: Minghui63 flag leaf, score: 64.284 | N | N | N | N |
| vg1008804375 | G -> A | LOC_Os10g17454-LOC_Os10g17470 | intergenic_region ; MODIFIER | silent_mutation | Average:48.739; most accessible tissue: Minghui63 flag leaf, score: 64.284 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1008804375 | 2.11E-06 | 8.17E-08 | mr1053 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008804375 | 4.37E-07 | 1.38E-09 | mr1070 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008804375 | 4.70E-06 | 2.64E-06 | mr1076 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008804375 | 2.44E-10 | 3.32E-12 | mr1128 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008804375 | 6.20E-06 | NA | mr1139 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008804375 | 4.92E-06 | 1.99E-06 | mr1147 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008804375 | NA | 3.80E-07 | mr1180 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008804375 | 6.90E-06 | NA | mr1204 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008804375 | NA | 1.02E-06 | mr1211 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008804375 | 6.98E-06 | NA | mr1436 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008804375 | 2.62E-06 | NA | mr1437 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008804375 | NA | 9.16E-07 | mr1503 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008804375 | 3.41E-06 | 2.71E-09 | mr1053_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008804375 | 3.54E-06 | NA | mr1070_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008804375 | 1.49E-08 | 1.32E-12 | mr1128_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008804375 | NA | 4.62E-08 | mr1147_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008804375 | NA | 1.14E-07 | mr1180_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008804375 | NA | 1.61E-07 | mr1183_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008804375 | NA | 1.31E-07 | mr1204_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008804375 | NA | 1.41E-06 | mr1264_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |