\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1008804375:

Variant ID: vg1008804375 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 8804375
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTGAAGTGAGCAACAGAAGAGGAGGCCGCTAGCCAAAAATGGGTCGGATTGGACCGGCCCCTGGTTCGGGCAAACCAGGGGTTCAGCTGAACCCATCCT[G/A]
GCGCCGTTAGATGGACGGTGTGGATTAGCCCCCAATGACGGTTGGAGGGTATTTTCGACCATTCCAACCGTCACAACCGTCATTGGGAGGCTATATAAGG

Reverse complement sequence

CCTTATATAGCCTCCCAATGACGGTTGTGACGGTTGGAATGGTCGAAAATACCCTCCAACCGTCATTGGGGGCTAATCCACACCGTCCATCTAACGGCGC[C/T]
AGGATGGGTTCAGCTGAACCCCTGGTTTGCCCGAACCAGGGGCCGGTCCAATCCGACCCATTTTTGGCTAGCGGCCTCCTCTTCTGTTGCTCACTTCAGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.80% 1.00% 2.18% 0.00% NA
All Indica  2759 94.70% 1.70% 3.59% 0.00% NA
All Japonica  1512 99.80% 0.00% 0.20% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 82.00% 5.20% 12.77% 0.00% NA
Indica II  465 99.10% 0.60% 0.22% 0.00% NA
Indica III  913 99.30% 0.20% 0.44% 0.00% NA
Indica Intermediate  786 96.20% 1.50% 2.29% 0.00% NA
Temperate Japonica  767 99.70% 0.00% 0.26% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 0.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1008804375 G -> A LOC_Os10g17470.1 upstream_gene_variant ; 844.0bp to feature; MODIFIER silent_mutation Average:48.739; most accessible tissue: Minghui63 flag leaf, score: 64.284 N N N N
vg1008804375 G -> A LOC_Os10g17454-LOC_Os10g17470 intergenic_region ; MODIFIER silent_mutation Average:48.739; most accessible tissue: Minghui63 flag leaf, score: 64.284 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1008804375 2.11E-06 8.17E-08 mr1053 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008804375 4.37E-07 1.38E-09 mr1070 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008804375 4.70E-06 2.64E-06 mr1076 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008804375 2.44E-10 3.32E-12 mr1128 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008804375 6.20E-06 NA mr1139 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008804375 4.92E-06 1.99E-06 mr1147 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008804375 NA 3.80E-07 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008804375 6.90E-06 NA mr1204 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008804375 NA 1.02E-06 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008804375 6.98E-06 NA mr1436 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008804375 2.62E-06 NA mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008804375 NA 9.16E-07 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008804375 3.41E-06 2.71E-09 mr1053_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008804375 3.54E-06 NA mr1070_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008804375 1.49E-08 1.32E-12 mr1128_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008804375 NA 4.62E-08 mr1147_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008804375 NA 1.14E-07 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008804375 NA 1.61E-07 mr1183_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008804375 NA 1.31E-07 mr1204_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008804375 NA 1.41E-06 mr1264_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251