Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1008794614:

Variant ID: vg1008794614 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 8794614
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:

GTCGTCCTCCCACCTCTTTAAATAGCTAGGTACCCATTCAGGGTTTCATAGATTTTTTTTAGGTTGTGTTTTGCTCTTTAAATGCACCCAGATATTGGTC[G/A]
TGATCAATTAGATCATAGTTTGTCTTCAGAACCTCTTTGCTATCAGTTCACCACTTCATTATCTAGCAAATATAAGTTTGCTTCTTCATATTTGTGCGCA

Reverse complement sequence

TGCGCACAAATATGAAGAAGCAAACTTATATTTGCTAGATAATGAAGTGGTGAACTGATAGCAAAGAGGTTCTGAAGACAAACTATGATCTAATTGATCA[C/T]
GACCAATATCTGGGTGCATTTAAAGAGCAAAACACAACCTAAAAAAAATCTATGAAACCCTGAATGGGTACCTAGCTATTTAAAGAGGTGGGAGGACGAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.50%	23.00%	0.44%	0.00%	NA
All Indica	2759	60.70%	38.60%	0.72%	0.00%	NA
All Japonica	1512	99.20%	0.70%	0.07%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	13.10%	86.60%	0.34%	0.00%	NA
Indica II	465	68.00%	29.20%	2.80%	0.00%	NA
Indica III	913	84.90%	15.10%	0.00%	0.00%	NA
Indica Intermediate	786	64.40%	35.00%	0.64%	0.00%	NA
Temperate Japonica	767	99.20%	0.70%	0.13%	0.00%	NA
Tropical Japonica	504	99.20%	0.80%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	84.40%	15.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1008794614	G -> A	LOC_Os10g17454.1	intron_variant ; MODIFIER	silent_mutation	Average:53.684; most accessible tissue: Zhenshan97 young leaf, score: 71.497	N	N	N	N
vg1008794614	G -> A	LOC_Os10g17454.2	intron_variant ; MODIFIER	silent_mutation	Average:53.684; most accessible tissue: Zhenshan97 young leaf, score: 71.497	N	N	N	N
vg1008794614	G -> A	LOC_Os10g17454.3	intron_variant ; MODIFIER	silent_mutation	Average:53.684; most accessible tissue: Zhenshan97 young leaf, score: 71.497	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1008794614	3.15E-09	4.69E-46	mr1026	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008794614	7.62E-09	5.85E-23	mr1026	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008794614	3.10E-08	4.35E-20	mr1118	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008794614	1.57E-12	1.12E-26	mr1118	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008794614	NA	8.35E-07	mr1120	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008794614	NA	2.93E-06	mr1123	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008794614	3.37E-09	1.25E-43	mr1161	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008794614	2.46E-09	6.47E-22	mr1161	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008794614	NA	9.54E-09	mr1242	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008794614	1.64E-09	1.23E-24	mr1495	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008794614	2.02E-12	9.81E-28	mr1495	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008794614	1.04E-07	3.24E-14	mr1496	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008794614	NA	1.63E-10	mr1794	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008794614	NA	5.94E-07	mr1936	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008794614	1.99E-06	1.15E-22	mr1118_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008794614	1.91E-11	1.31E-31	mr1118_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008794614	NA	5.85E-06	mr1120_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008794614	NA	1.05E-09	mr1123_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008794614	3.12E-07	7.18E-42	mr1161_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008794614	2.80E-06	4.29E-20	mr1161_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008794614	NA	2.83E-09	mr1242_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008794614	3.28E-08	1.76E-30	mr1495_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008794614	6.77E-11	8.30E-31	mr1495_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008794614	NA	3.69E-13	mr1496_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008794614	NA	6.11E-14	mr1794_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008794614	NA	2.68E-06	mr1870_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008794614	NA	4.95E-11	mr1936_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008794614	NA	4.89E-06	mr1961_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251