Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1008769988:

Variant ID: vg1008769988 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 8769988
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.74, T: 0.25, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


ATATCTTTGTGTTGTGGTAAGTCTTTTCTCTCCATTCCTCAAGTTCAGCGATCTGCATTTTTCTCCATTCTCCTGCTCCCTCAAAATCCATGTTCCAGTT[C/T]
CTGATGGCCAAGTATGCTCTGTGCTCAAGTTCTACAGGGAGTCGACATGGCTTCCCGTAAACTATCTGATGTGGGGACATTCTAATGGGTGTCTTGTATG

Reverse complement sequence

CATACAAGACACCCATTAGAATGTCCCCACATCAGATAGTTTACGGGAAGCCATGTCGACTCCCTGTAGAACTTGAGCACAGAGCATACTTGGCCATCAG[G/A]
AACTGGAACATGGATTTTGAGGGAGCAGGAGAATGGAGAAAAATGCAGATCGCTGAACTTGAGGAATGGAGAGAAAAGACTTACCACAACACAAAGATAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.10% 30.30% 0.23% 4.36% NA
All Indica  2759 95.50% 4.30% 0.04% 0.11% NA
All Japonica  1512 24.10% 62.30% 0.53% 13.03% NA
Aus  269 1.90% 98.10% 0.00% 0.00% NA
Indica I  595 97.30% 2.70% 0.00% 0.00% NA
Indica II  465 98.30% 1.50% 0.00% 0.22% NA
Indica III  913 95.20% 4.50% 0.11% 0.22% NA
Indica Intermediate  786 93.00% 7.00% 0.00% 0.00% NA
Temperate Japonica  767 6.80% 88.90% 0.26% 4.04% NA
Tropical Japonica  504 47.20% 21.60% 1.19% 29.96% NA
Japonica Intermediate  241 31.10% 62.70% 0.00% 6.22% NA
VI/Aromatic  96 24.00% 71.90% 2.08% 2.08% NA
Intermediate  90 52.20% 43.30% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1008769988 C -> T LOC_Os10g17400.1 synonymous_variant ; p.Arg856Arg; LOW synonymous_codon Average:49.066; most accessible tissue: Zhenshan97 young leaf, score: 71.923 N N N N
vg1008769988 C -> DEL LOC_Os10g17400.1 N frameshift_variant Average:49.066; most accessible tissue: Zhenshan97 young leaf, score: 71.923 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1008769988 NA 2.92E-14 mr1013 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008769988 NA 1.61E-12 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008769988 NA 1.32E-07 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008769988 NA 5.47E-13 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008769988 NA 4.58E-06 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008769988 NA 6.52E-15 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008769988 NA 7.51E-07 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008769988 NA 2.34E-09 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008769988 NA 1.91E-20 mr1179 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008769988 NA 1.78E-06 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008769988 NA 4.43E-25 mr1251 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008769988 NA 1.61E-31 mr1257 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008769988 NA 3.13E-17 mr1270 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008769988 NA 5.81E-08 mr1328 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008769988 NA 4.56E-06 mr1328 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008769988 NA 2.82E-12 mr1409 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008769988 NA 1.30E-10 mr1446 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008769988 NA 7.33E-06 mr1446 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008769988 NA 5.18E-09 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008769988 NA 2.72E-15 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008769988 NA 2.04E-15 mr1583 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008769988 NA 5.46E-08 mr1610 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008769988 NA 2.64E-07 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008769988 NA 5.84E-11 mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008769988 NA 2.02E-16 mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008769988 NA 5.91E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008769988 NA 1.24E-12 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008769988 NA 3.88E-23 mr1401_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008769988 NA 7.44E-27 mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008769988 NA 2.15E-11 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008769988 NA 5.93E-18 mr1583_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008769988 NA 9.48E-07 mr1632_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008769988 NA 1.59E-08 mr1707_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008769988 NA 3.78E-17 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008769988 NA 5.15E-11 mr1850_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008769988 NA 6.81E-09 mr1860_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008769988 NA 3.40E-07 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251