\
| Variant ID: vg1008749397 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 8749397 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GTGAAGCGGGCCCAAGTGATAGGTTGCCCCTCTGGCTGCGTAGCCTGGAAGTGGTCCCACCAGAGAGATGCGGGTCCCTGCAGTTGGTGGGCGGCGAAGA[T/C]
GACTTTCTCCTCATCGCTGCACTGCACAGTGTCTAACTTTTTTCCCACGGCATGCAACCAATCCAACGCATCCACGGGGTTGTTGGAGCTAGAGAAGGTA
TACCTTCTCTAGCTCCAACAACCCCGTGGATGCGTTGGATTGGTTGCATGCCGTGGGAAAAAAGTTAGACACTGTGCAGTGCAGCGATGAGGAGAAAGTC[A/G]
TCTTCGCCGCCCACCAACTGCAGGGACCCGCATCTCTCTGGTGGGACCACTTCCAGGCTACGCAGCCAGAGGGGCAACCTATCACTTGGGCCCGCTTCAC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.50% | 1.20% | 7.81% | 9.48% | NA |
| All Indica | 2759 | 84.50% | 0.00% | 7.65% | 7.79% | NA |
| All Japonica | 1512 | 72.40% | 3.80% | 8.73% | 15.15% | NA |
| Aus | 269 | 94.80% | 0.00% | 5.20% | 0.00% | NA |
| Indica I | 595 | 68.70% | 0.00% | 7.39% | 23.87% | NA |
| Indica II | 465 | 84.30% | 0.00% | 12.04% | 3.66% | NA |
| Indica III | 913 | 95.50% | 0.00% | 3.83% | 0.66% | NA |
| Indica Intermediate | 786 | 83.80% | 0.10% | 9.67% | 6.36% | NA |
| Temperate Japonica | 767 | 69.50% | 6.90% | 6.39% | 17.21% | NA |
| Tropical Japonica | 504 | 75.20% | 0.40% | 11.31% | 13.10% | NA |
| Japonica Intermediate | 241 | 75.50% | 0.80% | 10.79% | 12.86% | NA |
| VI/Aromatic | 96 | 90.60% | 1.00% | 7.29% | 1.04% | NA |
| Intermediate | 90 | 91.10% | 0.00% | 5.56% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1008749397 | T -> C | LOC_Os10g17360.1 | missense_variant ; p.Ile443Val; MODERATE | nonsynonymous_codon ; I443V | Average:28.717; most accessible tissue: Minghui63 panicle, score: 59.629 | benign |
0.049 |
TOLERATED | 0.28 |
| vg1008749397 | T -> DEL | LOC_Os10g17360.1 | N | frameshift_variant | Average:28.717; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1008749397 | NA | 4.36E-06 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008749397 | NA | 7.93E-08 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008749397 | NA | 2.38E-06 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008749397 | 4.36E-07 | 4.34E-07 | mr1703 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008749397 | NA | 8.91E-06 | mr1765 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008749397 | NA | 6.35E-06 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008749397 | NA | 2.40E-07 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |