\
| Variant ID: vg1008738737 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 8738737 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GTTGCGTACGATGTCCTTTGTCATAGGATTTGGGACTGCCCCTTTTTATGCCCAGATTCCTCATGATCGTCACGAAGAAAAGTGCCGAGTCAAAGTCACC[C/T]
TAAACAGTAATAGTGAAGATATCCCCTCAGTGATGTTCGAAGCTGGAGGAAGAAACTACATTCATGCATGTCAGGAGGTGGCAAGGATCGCCATAGGAGA
TCTCCTATGGCGATCCTTGCCACCTCCTGACATGCATGAATGTAGTTTCTTCCTCCAGCTTCGAACATCACTGAGGGGATATCTTCACTATTACTGTTTA[G/A]
GGTGACTTTGACTCGGCACTTTTCTTCGTGACGATCATGAGGAATCTGGGCATAAAAAGGGGCAGTCCCAAATCCTATGACAAAGGACATCGTACGCAAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.20% | 0.10% | 7.02% | 42.62% | NA |
| All Indica | 2759 | 57.80% | 0.20% | 3.95% | 38.09% | NA |
| All Japonica | 1512 | 46.60% | 0.10% | 0.86% | 52.45% | NA |
| Aus | 269 | 0.40% | 0.00% | 70.26% | 29.37% | NA |
| Indica I | 595 | 61.30% | 0.00% | 1.51% | 37.14% | NA |
| Indica II | 465 | 58.90% | 0.40% | 0.86% | 39.78% | NA |
| Indica III | 913 | 56.80% | 0.20% | 7.12% | 35.82% | NA |
| Indica Intermediate | 786 | 55.50% | 0.10% | 3.94% | 40.46% | NA |
| Temperate Japonica | 767 | 58.10% | 0.00% | 0.52% | 41.33% | NA |
| Tropical Japonica | 504 | 23.60% | 0.40% | 1.59% | 74.40% | NA |
| Japonica Intermediate | 241 | 57.70% | 0.00% | 0.41% | 41.91% | NA |
| VI/Aromatic | 96 | 27.10% | 0.00% | 14.58% | 58.33% | NA |
| Intermediate | 90 | 53.30% | 0.00% | 7.78% | 38.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1008738737 | C -> T | LOC_Os10g17350.1 | synonymous_variant ; p.Leu74Leu; LOW | synonymous_codon | Average:13.306; most accessible tissue: Callus, score: 19.293 | N | N | N | N |
| vg1008738737 | C -> DEL | LOC_Os10g17350.1 | N | frameshift_variant | Average:13.306; most accessible tissue: Callus, score: 19.293 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1008738737 | NA | 3.56E-07 | mr1113 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008738737 | NA | 7.51E-06 | mr1116 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008738737 | NA | 4.95E-12 | mr1118 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008738737 | NA | 9.98E-10 | mr1161 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008738737 | NA | 6.61E-25 | mr1495 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008738737 | NA | 3.47E-14 | mr1495 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008738737 | NA | 5.57E-06 | mr1496 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008738737 | 1.13E-06 | NA | mr1798 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008738737 | NA | 3.52E-06 | mr1798 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008738737 | NA | 1.48E-06 | mr1113_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008738737 | NA | 5.66E-07 | mr1114_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008738737 | NA | 3.28E-14 | mr1118_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008738737 | NA | 3.79E-07 | mr1120_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008738737 | NA | 2.15E-09 | mr1161_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008738737 | NA | 3.28E-06 | mr1247_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008738737 | NA | 3.91E-14 | mr1495_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |