\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1008709315:

Variant ID: vg1008709315 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 8709315
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAACCTTGTCCTTGTTTGTCATCGAGATCATCTACCGTGTCCTTGGTGTAGACATTTGAACCCTCCATGATGCCCTAAAAACAATAATTTGGGCTCTCC[A/G]
TCTTCAATTGGTTGTATATCACAACCGGACACTTTTAGAAAATCTCAATCCCAAACCTTTCCAGACAAGCAATCAATACCGTCCATATCCCAAAGAGCTA

Reverse complement sequence

TAGCTCTTTGGGATATGGACGGTATTGATTGCTTGTCTGGAAAGGTTTGGGATTGAGATTTTCTAAAAGTGTCCGGTTGTGATATACAACCAATTGAAGA[T/C]
GGAGAGCCCAAATTATTGTTTTTAGGGCATCATGGAGGGTTCAAATGTCTACACCAAGGACACGGTAGATGATCTCGATGACAAACAAGGACAAGGTTTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.90% 20.70% 0.38% 0.00% NA
All Indica  2759 96.60% 3.40% 0.00% 0.00% NA
All Japonica  1512 64.40% 34.40% 1.19% 0.00% NA
Aus  269 1.90% 98.10% 0.00% 0.00% NA
Indica I  595 98.50% 1.50% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 95.80% 4.20% 0.00% 0.00% NA
Indica Intermediate  786 94.50% 5.50% 0.00% 0.00% NA
Temperate Japonica  767 64.30% 33.50% 2.22% 0.00% NA
Tropical Japonica  504 55.00% 45.00% 0.00% 0.00% NA
Japonica Intermediate  241 84.60% 14.90% 0.41% 0.00% NA
VI/Aromatic  96 24.00% 76.00% 0.00% 0.00% NA
Intermediate  90 70.00% 30.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1008709315 A -> G LOC_Os10g17310.1 upstream_gene_variant ; 251.0bp to feature; MODIFIER silent_mutation Average:38.672; most accessible tissue: Zhenshan97 flag leaf, score: 53.034 N N N N
vg1008709315 A -> G LOC_Os10g17320.1 upstream_gene_variant ; 3988.0bp to feature; MODIFIER silent_mutation Average:38.672; most accessible tissue: Zhenshan97 flag leaf, score: 53.034 N N N N
vg1008709315 A -> G LOC_Os10g17300.1 downstream_gene_variant ; 3688.0bp to feature; MODIFIER silent_mutation Average:38.672; most accessible tissue: Zhenshan97 flag leaf, score: 53.034 N N N N
vg1008709315 A -> G LOC_Os10g17310-LOC_Os10g17320 intergenic_region ; MODIFIER silent_mutation Average:38.672; most accessible tissue: Zhenshan97 flag leaf, score: 53.034 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1008709315 NA 4.04E-06 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008709315 NA 8.25E-11 mr1180 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008709315 NA 3.68E-14 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008709315 2.96E-06 NA mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008709315 NA 7.15E-17 mr1409 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008709315 NA 4.41E-14 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008709315 NA 1.22E-08 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008709315 NA 7.49E-12 mr1649 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008709315 NA 1.22E-09 mr1794 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008709315 NA 3.50E-08 mr1929 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008709315 NA 4.10E-06 mr1976 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008709315 NA 2.20E-16 mr1180_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008709315 5.32E-06 NA mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008709315 NA 2.13E-06 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008709315 NA 4.62E-08 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008709315 NA 5.94E-20 mr1409_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008709315 NA 2.44E-07 mr1409_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008709315 9.31E-06 4.68E-10 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008709315 NA 5.48E-08 mr1559_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008709315 NA 1.98E-07 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008709315 NA 2.34E-13 mr1649_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008709315 NA 3.51E-15 mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251