\
| Variant ID: vg1008681328 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 8681328 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.83, T: 0.17, others allele: 0.00, population size: 70. )
AAAAAGGATTATTTGGTGTATAATACAGAAAAATTTATGAACACGCTGGTATATATGAGTTACTTGCTCCGTTTTACGTTATAAGTCGTTTTATTTTTTT[C/T]
CTAGTTAAATTTCTTTAAGTTTAACCAAGTATATAGAAAAATATAATAGTATTTTCAACCCAAAACAAACATATTATTTCCTCCGTTACATTATGTAAGA
TCTTACATAATGTAACGGAGGAAATAATATGTTTGTTTTGGGTTGAAAATACTATTATATTTTTCTATATACTTGGTTAAACTTAAAGAAATTTAACTAG[G/A]
AAAAAAATAAAACGACTTATAACGTAAAACGGAGCAAGTAACTCATATATACCAGCGTGTTCATAAATTTTTCTGTATTATACACCAAATAATCCTTTTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.10% | 49.70% | 0.17% | 0.00% | NA |
| All Indica | 2759 | 60.50% | 39.30% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 42.00% | 57.90% | 0.13% | 0.00% | NA |
| Aus | 269 | 1.10% | 98.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 88.20% | 11.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 39.60% | 60.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 59.60% | 40.20% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 52.90% | 46.80% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 40.80% | 59.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 47.80% | 52.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 33.60% | 66.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 28.10% | 70.80% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 37.80% | 62.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1008681328 | C -> T | LOC_Os10g17250.1 | upstream_gene_variant ; 3249.0bp to feature; MODIFIER | silent_mutation | Average:68.571; most accessible tissue: Zhenshan97 root, score: 83.087 | N | N | N | N |
| vg1008681328 | C -> T | LOC_Os10g17260.1 | downstream_gene_variant ; 44.0bp to feature; MODIFIER | silent_mutation | Average:68.571; most accessible tissue: Zhenshan97 root, score: 83.087 | N | N | N | N |
| vg1008681328 | C -> T | LOC_Os10g17270.1 | downstream_gene_variant ; 1465.0bp to feature; MODIFIER | silent_mutation | Average:68.571; most accessible tissue: Zhenshan97 root, score: 83.087 | N | N | N | N |
| vg1008681328 | C -> T | LOC_Os10g17260-LOC_Os10g17270 | intergenic_region ; MODIFIER | silent_mutation | Average:68.571; most accessible tissue: Zhenshan97 root, score: 83.087 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1008681328 | 3.08E-07 | NA | mr1027 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008681328 | 1.62E-06 | 1.62E-06 | mr1027 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008681328 | NA | 3.06E-06 | mr1495 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008681328 | NA | 7.49E-08 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008681328 | NA | 2.48E-11 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008681328 | 5.67E-07 | NA | mr1027_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008681328 | NA | 8.54E-09 | mr1027_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008681328 | NA | 6.20E-07 | mr1118_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008681328 | NA | 3.20E-10 | mr1495_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008681328 | NA | 1.87E-06 | mr1580_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008681328 | NA | 1.61E-10 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008681328 | NA | 1.21E-10 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008681328 | NA | 6.08E-06 | mr1825_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |