\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1008681328:

Variant ID: vg1008681328 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 8681328
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.83, T: 0.17, others allele: 0.00, population size: 70. )

Flanking Sequence (100 bp) in Reference Genome:


AAAAAGGATTATTTGGTGTATAATACAGAAAAATTTATGAACACGCTGGTATATATGAGTTACTTGCTCCGTTTTACGTTATAAGTCGTTTTATTTTTTT[C/T]
CTAGTTAAATTTCTTTAAGTTTAACCAAGTATATAGAAAAATATAATAGTATTTTCAACCCAAAACAAACATATTATTTCCTCCGTTACATTATGTAAGA

Reverse complement sequence

TCTTACATAATGTAACGGAGGAAATAATATGTTTGTTTTGGGTTGAAAATACTATTATATTTTTCTATATACTTGGTTAAACTTAAAGAAATTTAACTAG[G/A]
AAAAAAATAAAACGACTTATAACGTAAAACGGAGCAAGTAACTCATATATACCAGCGTGTTCATAAATTTTTCTGTATTATACACCAAATAATCCTTTTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.10% 49.70% 0.17% 0.00% NA
All Indica  2759 60.50% 39.30% 0.18% 0.00% NA
All Japonica  1512 42.00% 57.90% 0.13% 0.00% NA
Aus  269 1.10% 98.90% 0.00% 0.00% NA
Indica I  595 88.20% 11.80% 0.00% 0.00% NA
Indica II  465 39.60% 60.20% 0.22% 0.00% NA
Indica III  913 59.60% 40.20% 0.22% 0.00% NA
Indica Intermediate  786 52.90% 46.80% 0.25% 0.00% NA
Temperate Japonica  767 40.80% 59.20% 0.00% 0.00% NA
Tropical Japonica  504 47.80% 52.00% 0.20% 0.00% NA
Japonica Intermediate  241 33.60% 66.00% 0.41% 0.00% NA
VI/Aromatic  96 28.10% 70.80% 1.04% 0.00% NA
Intermediate  90 37.80% 62.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1008681328 C -> T LOC_Os10g17250.1 upstream_gene_variant ; 3249.0bp to feature; MODIFIER silent_mutation Average:68.571; most accessible tissue: Zhenshan97 root, score: 83.087 N N N N
vg1008681328 C -> T LOC_Os10g17260.1 downstream_gene_variant ; 44.0bp to feature; MODIFIER silent_mutation Average:68.571; most accessible tissue: Zhenshan97 root, score: 83.087 N N N N
vg1008681328 C -> T LOC_Os10g17270.1 downstream_gene_variant ; 1465.0bp to feature; MODIFIER silent_mutation Average:68.571; most accessible tissue: Zhenshan97 root, score: 83.087 N N N N
vg1008681328 C -> T LOC_Os10g17260-LOC_Os10g17270 intergenic_region ; MODIFIER silent_mutation Average:68.571; most accessible tissue: Zhenshan97 root, score: 83.087 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1008681328 3.08E-07 NA mr1027 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008681328 1.62E-06 1.62E-06 mr1027 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008681328 NA 3.06E-06 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008681328 NA 7.49E-08 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008681328 NA 2.48E-11 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008681328 5.67E-07 NA mr1027_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008681328 NA 8.54E-09 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008681328 NA 6.20E-07 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008681328 NA 3.20E-10 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008681328 NA 1.87E-06 mr1580_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008681328 NA 1.61E-10 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008681328 NA 1.21E-10 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008681328 NA 6.08E-06 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251