Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1008658227:

Variant ID: vg1008658227 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 8658227
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

CCGATGAGTTATCTGGATATTGTTTAAGTGTTGCATCGACTTATAAGGATTATATACAAGTTGGTTTTAGCCGATTGTAGCAAAGGCTTTATTGATTACT[T/C]
AATCATTTGTATTTAATGACATCGGATTTTCAGCCGATGCATATTTTAACCATCGAATCAACATCGATCGATTGGTTCATTGGGTATTTATTTAATTACT

Reverse complement sequence

AGTAATTAAATAAATACCCAATGAACCAATCGATCGATGTTGATTCGATGGTTAAAATATGCATCGGCTGAAAATCCGATGTCATTAAATACAAATGATT[A/G]
AGTAATCAATAAAGCCTTTGCTACAATCGGCTAAAACCAACTTGTATATAATCCTTATAAGTCGATGCAACACTTAAACAATATCCAGATAACTCATCGG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.40%	20.80%	0.25%	6.52%	NA
All Indica	2759	64.40%	34.80%	0.11%	0.72%	NA
All Japonica	1512	82.70%	0.90%	0.60%	15.87%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	13.30%	86.60%	0.17%	0.00%	NA
Indica II	465	83.70%	16.10%	0.00%	0.22%	NA
Indica III	913	83.40%	14.70%	0.22%	1.75%	NA
Indica Intermediate	786	69.70%	29.90%	0.00%	0.38%	NA
Temperate Japonica	767	93.70%	0.80%	0.39%	5.08%	NA
Tropical Japonica	504	61.90%	0.80%	1.19%	36.11%	NA
Japonica Intermediate	241	90.90%	1.20%	0.00%	7.88%	NA
VI/Aromatic	96	62.50%	0.00%	0.00%	37.50%	NA
Intermediate	90	73.30%	13.30%	0.00%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1008658227	T -> C	LOC_Os10g17220.1	upstream_gene_variant ; 3174.0bp to feature; MODIFIER	silent_mutation	Average:31.307; most accessible tissue: Callus, score: 71.43	N	N	N	N
vg1008658227	T -> C	LOC_Os10g17220-LOC_Os10g17230	intergenic_region ; MODIFIER	silent_mutation	Average:31.307; most accessible tissue: Callus, score: 71.43	N	N	N	N
vg1008658227	T -> DEL	N	N	silent_mutation	Average:31.307; most accessible tissue: Callus, score: 71.43	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1008658227	9.63E-09	1.46E-38	mr1026	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008658227	2.90E-10	3.56E-23	mr1026	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008658227	NA	3.04E-08	mr1113	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008658227	NA	1.22E-07	mr1114	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008658227	NA	4.23E-06	mr1116	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008658227	1.10E-06	6.10E-17	mr1118	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008658227	3.61E-11	1.35E-22	mr1118	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008658227	NA	8.59E-07	mr1120	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008658227	4.39E-08	6.04E-36	mr1161	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008658227	2.61E-10	1.05E-21	mr1161	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008658227	NA	6.61E-06	mr1242	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008658227	NA	6.32E-06	mr1247	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008658227	5.38E-06	1.32E-22	mr1495	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008658227	1.50E-08	2.14E-26	mr1495	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008658227	NA	1.09E-10	mr1496	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008658227	2.98E-06	NA	mr1794	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008658227	3.67E-07	1.92E-13	mr1794	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008658227	NA	8.67E-06	mr1917	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008658227	NA	5.10E-06	mr1936	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008658227	NA	1.39E-06	mr1113_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008658227	NA	6.76E-07	mr1114_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008658227	3.12E-06	3.85E-22	mr1118_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008658227	1.58E-10	3.22E-30	mr1118_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008658227	NA	4.09E-09	mr1120_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008658227	NA	7.41E-08	mr1123_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008658227	1.66E-09	2.37E-39	mr1161_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008658227	5.56E-11	8.51E-24	mr1161_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008658227	NA	5.28E-07	mr1247_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008658227	2.94E-08	8.76E-32	mr1495_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008658227	2.71E-10	2.04E-32	mr1495_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008658227	NA	6.52E-11	mr1496_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008658227	NA	9.89E-08	mr1531_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008658227	NA	7.01E-06	mr1580_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008658227	NA	3.65E-16	mr1794_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008658227	NA	3.41E-06	mr1825_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008658227	NA	4.05E-06	mr1870_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008658227	NA	6.05E-07	mr1904_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008658227	NA	8.94E-11	mr1936_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008658227	NA	2.26E-06	mr1961_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251