RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg1008658227:

Variant ID: vg1008658227 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 8658227
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

CCGATGAGTTATCTGGATATTGTTTAAGTGTTGCATCGACTTATAAGGATTATATACAAGTTGGTTTTAGCCGATTGTAGCAAAGGCTTTATTGATTACT[T/C]
AATCATTTGTATTTAATGACATCGGATTTTCAGCCGATGCATATTTTAACCATCGAATCAACATCGATCGATTGGTTCATTGGGTATTTATTTAATTACT

Reverse complement sequence

AGTAATTAAATAAATACCCAATGAACCAATCGATCGATGTTGATTCGATGGTTAAAATATGCATCGGCTGAAAATCCGATGTCATTAAATACAAATGATT[A/G]
AGTAATCAATAAAGCCTTTGCTACAATCGGCTAAAACCAACTTGTATATAATCCTTATAAGTCGATGCAACACTTAAACAATATCCAGATAACTCATCGG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.40%	20.80%	0.25%	6.52%	NA
All Indica	2759	64.40%	34.80%	0.11%	0.72%	NA
All Japonica	1512	82.70%	0.90%	0.60%	15.87%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	13.30%	86.60%	0.17%	0.00%	NA
Indica II	465	83.70%	16.10%	0.00%	0.22%	NA
Indica III	913	83.40%	14.70%	0.22%	1.75%	NA
Indica Intermediate	786	69.70%	29.90%	0.00%	0.38%	NA
Temperate Japonica	767	93.70%	0.80%	0.39%	5.08%	NA
Tropical Japonica	504	61.90%	0.80%	1.19%	36.11%	NA
Japonica Intermediate	241	90.90%	1.20%	0.00%	7.88%	NA
VI/Aromatic	96	62.50%	0.00%	0.00%	37.50%	NA
Intermediate	90	73.30%	13.30%	0.00%	13.33%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1008658227	T -> C	LOC_Os10g17220.1	upstream_gene_variant ; 3174.0bp to feature; MODIFIER	silent_mutation	Average:31.307; most accessible tissue: Callus, score: 71.43	N	N	N	N
vg1008658227	T -> C	LOC_Os10g17220-LOC_Os10g17230	intergenic_region ; MODIFIER	silent_mutation	Average:31.307; most accessible tissue: Callus, score: 71.43	N	N	N	N
vg1008658227	T -> DEL	N	N	silent_mutation	Average:31.307; most accessible tissue: Callus, score: 71.43	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1008658227	9.63E-09	1.46E-38	mr1026	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008658227	2.90E-10	3.56E-23	mr1026	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008658227	NA	3.04E-08	mr1113	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008658227	NA	1.22E-07	mr1114	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008658227	NA	4.23E-06	mr1116	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008658227	1.10E-06	6.10E-17	mr1118	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008658227	3.61E-11	1.35E-22	mr1118	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008658227	NA	8.59E-07	mr1120	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008658227	4.39E-08	6.04E-36	mr1161	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008658227	2.61E-10	1.05E-21	mr1161	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 39 entries

Previous1 2 3 4Next

Search for Variation information by Variation ID:

Detailed information for vg1008658227:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact