\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1008640554:

Variant ID: vg1008640554 (JBrowse)Variation Type: INDEL
Chromosome: chr10Position: 8640554
Reference Allele: AAlternative Allele: T,ATTTT
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGACAAATTCGACTTTGATTTGACAAAGTTGACTACAGTTTGTATTATTTTACTATAATTTGATAACTTTCACTTCAAGTTGGTAGATGTTTGAAAAAAA[A/T,ATTTT]
TTTTATTTGACAAAAATATATGAATTAAGTTTAATAAAAATTTAACAAATCCATCCCAAATTGCATATACTGAAGAAATAAACACACACATGTAGTATAT

Reverse complement sequence

ATATACTACATGTGTGTGTTTATTTCTTCAGTATATGCAATTTGGGATGGATTTGTTAAATTTTTATTAAACTTAATTCATATATTTTTGTCAAATAAAA[T/A,AAAAT]
TTTTTTTCAAACATCTACCAACTTGAAGTGAAAGTTATCAAATTATAGTAAAATAATACAAACTGTAGTCAACTTTGTCAAATCAAAGTCGAATTTGTCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.70% 6.20% 1.90% 6.20% ATTTT: 0.02%
All Indica  2759 98.80% 0.30% 0.22% 0.76% NA
All Japonica  1512 65.70% 14.60% 4.63% 15.01% NA
Aus  269 77.00% 19.30% 3.72% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 99.40% 0.20% 0.22% 0.22% NA
Indica III  913 97.90% 0.10% 0.00% 1.97% NA
Indica Intermediate  786 98.60% 0.60% 0.51% 0.25% NA
Temperate Japonica  767 62.20% 26.50% 6.78% 4.56% NA
Tropical Japonica  504 61.10% 1.60% 2.98% 34.33% NA
Japonica Intermediate  241 86.70% 4.10% 1.24% 7.88% NA
VI/Aromatic  96 57.30% 7.30% 1.04% 34.38% NA
Intermediate  90 77.80% 4.40% 3.33% 13.33% ATTTT: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1008640554 A -> ATTTT LOC_Os10g17180-LOC_Os10g17210 intergenic_region ; MODIFIER silent_mutation Average:73.694; most accessible tissue: Zhenshan97 flag leaf, score: 86.884 N N N N
vg1008640554 A -> T LOC_Os10g17180-LOC_Os10g17210 intergenic_region ; MODIFIER silent_mutation Average:73.694; most accessible tissue: Zhenshan97 flag leaf, score: 86.884 N N N N
vg1008640554 A -> DEL N N silent_mutation Average:73.694; most accessible tissue: Zhenshan97 flag leaf, score: 86.884 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1008640554 5.91E-07 NA mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008640554 NA 8.32E-10 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008640554 3.47E-08 NA mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008640554 6.07E-06 6.84E-09 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008640554 5.97E-06 NA mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008640554 NA 3.85E-09 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008640554 NA 6.24E-07 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008640554 NA 5.01E-11 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008640554 NA 1.20E-08 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008640554 NA 2.46E-06 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008640554 3.35E-11 NA mr1305_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008640554 6.55E-06 3.14E-10 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008640554 NA 5.87E-08 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008640554 NA 7.23E-08 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008640554 2.61E-10 1.28E-13 mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008640554 1.10E-06 7.70E-16 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008640554 NA 2.49E-06 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008640554 NA 1.56E-06 mr1793_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008640554 NA 7.47E-06 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251