\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1008589261:

Variant ID: vg1008589261 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 8589261
Reference Allele: CAlternative Allele: A,T
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGACGAAGCTGAGTCCGTCTCAGGCTAAGCGCGTCTTGTGCGCGTGCGGGCCTCCTGATAGGCTGAAACCGAGATATTTCGACCTGTAGGCGGGCCCAAG[C/A,T]
GCCATCTCCATTGGATTCGTTTTGGACAGCCGAGATGCATGGTATGTCTCGTTGTGACTTGCCTACGCTAAGTAACCAAAGCTGAGTCCCGCTGGTGAGG

Reverse complement sequence

CCTCACCAGCGGGACTCAGCTTTGGTTACTTAGCGTAGGCAAGTCACAACGAGACATACCATGCATCTCGGCTGTCCAAAACGAATCCAATGGAGATGGC[G/T,A]
CTTGGGCCCGCCTACAGGTCGAAATATCTCGGTTTCAGCCTATCAGGAGGCCCGCACGCGCACAAGACGCGCTTAGCCTGAGACGGACTCAGCTTCGTCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.40% 35.30% 1.29% 0.02% T: 0.04%
All Indica  2759 93.40% 4.50% 1.96% 0.04% T: 0.07%
All Japonica  1512 23.00% 76.70% 0.33% 0.00% NA
Aus  269 1.90% 98.10% 0.00% 0.00% NA
Indica I  595 97.60% 2.00% 0.34% 0.00% NA
Indica II  465 94.80% 1.70% 3.44% 0.00% NA
Indica III  913 92.20% 5.00% 2.52% 0.11% T: 0.11%
Indica Intermediate  786 90.80% 7.40% 1.65% 0.00% T: 0.13%
Temperate Japonica  767 5.70% 94.10% 0.13% 0.00% NA
Tropical Japonica  504 45.60% 53.60% 0.79% 0.00% NA
Japonica Intermediate  241 30.70% 69.30% 0.00% 0.00% NA
VI/Aromatic  96 22.90% 77.10% 0.00% 0.00% NA
Intermediate  90 45.60% 52.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1008589261 C -> T LOC_Os10g17110-LOC_Os10g17120 intergenic_region ; MODIFIER silent_mutation Average:69.807; most accessible tissue: Zhenshan97 young leaf, score: 84.814 N N N N
vg1008589261 C -> A LOC_Os10g17110-LOC_Os10g17120 intergenic_region ; MODIFIER silent_mutation Average:69.807; most accessible tissue: Zhenshan97 young leaf, score: 84.814 N N N N
vg1008589261 C -> DEL N N silent_mutation Average:69.807; most accessible tissue: Zhenshan97 young leaf, score: 84.814 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1008589261 C A -0.03 -0.02 -0.03 -0.05 -0.07 -0.07
vg1008589261 C T 0.17 0.12 0.08 0.12 0.11 0.11

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1008589261 1.79E-07 1.79E-07 mr1110 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008589261 NA 4.33E-11 mr1180 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008589261 NA 2.27E-15 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008589261 NA 9.91E-15 mr1199 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008589261 NA 3.79E-29 mr1208 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008589261 NA 1.27E-08 mr1260 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008589261 NA 2.10E-15 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008589261 NA 6.54E-18 mr1583 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008589261 NA 7.02E-10 mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008589261 NA 2.84E-11 mr1794 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008589261 NA 3.87E-08 mr1929 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008589261 NA 5.62E-06 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008589261 NA 5.59E-20 mr1180_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008589261 NA 1.70E-24 mr1183_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008589261 NA 4.21E-11 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008589261 NA 5.10E-17 mr1260_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008589261 NA 4.15E-09 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008589261 NA 2.19E-15 mr1583_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008589261 NA 1.77E-09 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008589261 NA 5.26E-13 mr1850_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251