\
| Variant ID: vg1008541700 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 8541700 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 232. )
CATTTCCATTCCTGGATTTGAAGAGGTTGGAGTAAACCTGCTGGTCTTTGGTGCTCTGCCTTCACTCGTTGACAAACATCGCAGAGTACGACGAATTCAG[C/G]
TATTTCTCTCCTCATGCTGACCCACCAAAACTTTTCTTTGAGGTCTTGATACATTTTGGTGCTGCCTGGATGAATGGAGTACTGGGTCTGATGAGCCTCG
CGAGGCTCATCAGACCCAGTACTCCATTCATCCAGGCAGCACCAAAATGTATCAAGACCTCAAAGAAAAGTTTTGGTGGGTCAGCATGAGGAGAGAAATA[G/C]
CTGAATTCGTCGTACTCTGCGATGTTTGTCAACGAGTGAAGGCAGAGCACCAAAGACCAGCAGGTTTACTCCAACCTCTTCAAATCCAGGAATGGAAATG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.40% | 20.90% | 25.41% | 14.33% | NA |
| All Indica | 2759 | 38.40% | 34.80% | 23.52% | 3.26% | NA |
| All Japonica | 1512 | 48.30% | 0.70% | 17.33% | 33.60% | NA |
| Aus | 269 | 2.60% | 0.40% | 75.84% | 21.19% | NA |
| Indica I | 595 | 9.70% | 86.60% | 2.02% | 1.68% | NA |
| Indica II | 465 | 60.40% | 17.00% | 15.91% | 6.67% | NA |
| Indica III | 913 | 41.80% | 14.70% | 42.72% | 0.77% | NA |
| Indica Intermediate | 786 | 43.00% | 29.60% | 22.01% | 5.34% | NA |
| Temperate Japonica | 767 | 55.00% | 0.70% | 2.35% | 41.98% | NA |
| Tropical Japonica | 504 | 32.90% | 0.80% | 42.46% | 23.81% | NA |
| Japonica Intermediate | 241 | 59.30% | 0.80% | 12.45% | 27.39% | NA |
| VI/Aromatic | 96 | 26.00% | 0.00% | 60.42% | 13.54% | NA |
| Intermediate | 90 | 44.40% | 14.40% | 31.11% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1008541700 | C -> G | LOC_Os10g17050.1 | missense_variant ; p.Ala1088Pro; MODERATE | nonsynonymous_codon ; A1088P | Average:20.662; most accessible tissue: Zhenshan97 flag leaf, score: 36.135 | probably damaging |
2.39 |
DELETERIOUS | 0.00 |
| vg1008541700 | C -> DEL | LOC_Os10g17050.1 | N | frameshift_variant | Average:20.662; most accessible tissue: Zhenshan97 flag leaf, score: 36.135 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1008541700 | 1.73E-09 | 2.86E-39 | mr1026 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008541700 | 8.49E-10 | 7.39E-21 | mr1026 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008541700 | 2.24E-06 | NA | mr1110 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008541700 | NA | 5.25E-06 | mr1113 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008541700 | NA | 1.89E-06 | mr1114 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008541700 | 8.12E-09 | 6.59E-19 | mr1118 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008541700 | 1.13E-12 | 9.38E-23 | mr1118 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008541700 | 9.10E-09 | 8.23E-37 | mr1161 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008541700 | 2.05E-09 | 1.44E-19 | mr1161 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008541700 | 6.23E-08 | 8.85E-24 | mr1495 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008541700 | 6.63E-10 | 1.54E-24 | mr1495 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008541700 | 2.98E-06 | 2.82E-11 | mr1496 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008541700 | NA | 8.85E-06 | mr1789 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008541700 | NA | 2.41E-10 | mr1794 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008541700 | NA | 8.52E-06 | mr1936 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008541700 | 7.86E-08 | 3.39E-23 | mr1118_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008541700 | 3.73E-13 | 4.76E-30 | mr1118_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008541700 | NA | 8.86E-07 | mr1120_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008541700 | NA | 1.16E-07 | mr1123_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008541700 | 9.65E-12 | 3.07E-42 | mr1161_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008541700 | 5.69E-11 | 8.24E-24 | mr1161_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008541700 | NA | 7.97E-07 | mr1242_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008541700 | 1.03E-08 | 2.12E-31 | mr1495_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008541700 | 6.92E-11 | 1.14E-29 | mr1495_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008541700 | NA | 1.43E-11 | mr1496_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008541700 | NA | 3.95E-07 | mr1531_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008541700 | 5.95E-06 | NA | mr1580_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008541700 | 6.72E-07 | 6.86E-07 | mr1580_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008541700 | NA | 3.56E-13 | mr1794_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008541700 | 2.05E-06 | NA | mr1825_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008541700 | 2.09E-07 | 2.81E-07 | mr1825_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008541700 | NA | 1.45E-06 | mr1870_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008541700 | NA | 2.99E-07 | mr1904_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008541700 | 9.83E-06 | 2.26E-11 | mr1936_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |