RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg1008474924:

Variant ID: vg1008474924 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 8474924
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, A: 0.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

TTCCTCCAATACTTTGAGTAGCTCAACACCTTGGTGAAAATTTTGCAAGTGTCAGATTGGAGATCCGTTTGCAAAAACGAAACCTACGGGACAAGAGCAT[T/A]
CCATTTTTGTATAATTTTGATTTCGGTTGGGACTTTTACATTTAAGTCCTAGTGATTTTTGTATTTACATTTGAGTCCCTGCAATTTTGCATTGAGGTGC

Reverse complement sequence

GCACCTCAATGCAAAATTGCAGGGACTCAAATGTAAATACAAAAATCACTAGGACTTAAATGTAAAAGTCCCAACCGAAATCAAAATTATACAAAAATGG[A/T]
ATGCTCTTGTCCCGTAGGTTTCGTTTTTGCAAACGGATCTCCAATCTGACACTTGCAAAATTTTCACCAAGGTGTTGAGCTACTCAAAGTATTGGAGGAA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.20%	19.50%	0.15%	20.10%	NA
All Indica	2759	40.70%	25.40%	0.22%	33.67%	NA
All Japonica	1512	85.90%	13.70%	0.07%	0.33%	NA
Aus	269	98.10%	1.10%	0.00%	0.74%	NA
Indica I	595	89.20%	1.70%	0.00%	9.08%	NA
Indica II	465	19.10%	23.90%	0.43%	56.56%	NA
Indica III	913	20.80%	44.80%	0.33%	34.06%	NA
Indica Intermediate	786	39.80%	21.80%	0.13%	38.30%	NA
Temperate Japonica	767	95.20%	4.60%	0.00%	0.26%	NA
Tropical Japonica	504	77.60%	22.40%	0.00%	0.00%	NA
Japonica Intermediate	241	73.90%	24.50%	0.41%	1.24%	NA
VI/Aromatic	96	97.90%	1.00%	0.00%	1.04%	NA
Intermediate	90	73.30%	12.20%	0.00%	14.44%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1008474924	T -> A	LOC_Os10g16930-LOC_Os10g16950	intergenic_region ; MODIFIER	silent_mutation	Average:39.432; most accessible tissue: Zhenshan97 young leaf, score: 56.533	N	N	N	N
vg1008474924	T -> DEL	N	N	silent_mutation	Average:39.432; most accessible tissue: Zhenshan97 young leaf, score: 56.533	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1008474924	NA	2.89E-08	Grain_thickness	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1008474924	9.01E-07	3.75E-17	mr1026	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008474924	NA	7.07E-06	mr1080	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008474924	1.36E-07	NA	mr1110	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008474924	4.80E-06	NA	mr1110	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008474924	1.19E-07	1.74E-13	mr1113	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008474924	4.54E-08	4.62E-13	mr1114	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008474924	8.26E-08	NA	mr1116	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008474924	1.43E-09	2.53E-14	mr1116	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008474924	NA	2.70E-06	mr1117	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 61 entries

Previous1 2 3 4 5 6 7Next

Search for Variation information by Variation ID:

Detailed information for vg1008474924:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact