Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1008447547:

Variant ID: vg1008447547 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 8447547
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:


AATTTTATTTGTAAACAAAATAATTTCGCAATTGGGATCAACATGTTCAAAGAATAGTGATGACTTGCCTTGCTCGTAGTCCTGCGGGTCTTGATCCTTG[C/G]
TCGGATCCGCAACTCCCTCGGGCTCTAAAATTACGTGCGAAGAAATGATTTGAATTCAGTTAGAATTCAAATAAAATCCAAATAAACTCAAATAAAAGTC

Reverse complement sequence

GACTTTTATTTGAGTTTATTTGGATTTTATTTGAATTCTAACTGAATTCAAATCATTTCTTCGCACGTAATTTTAGAGCCCGAGGGAGTTGCGGATCCGA[G/C]
CAAGGATCAAGACCCGCAGGACTACGAGCAAGGCAAGTCATCACTATTCTTTGAACATGTTGATCCCAATTGCGAAATTATTTTGTTTACAAATAAAATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.90% 19.00% 0.19% 0.00% NA
All Indica  2759 75.10% 24.60% 0.25% 0.00% NA
All Japonica  1512 86.60% 13.40% 0.00% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 98.30% 1.70% 0.00% 0.00% NA
Indica II  465 77.20% 22.40% 0.43% 0.00% NA
Indica III  913 55.60% 43.90% 0.44% 0.00% NA
Indica Intermediate  786 78.90% 21.00% 0.13% 0.00% NA
Temperate Japonica  767 95.30% 4.70% 0.00% 0.00% NA
Tropical Japonica  504 78.40% 21.60% 0.00% 0.00% NA
Japonica Intermediate  241 75.90% 24.10% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 87.80% 10.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1008447547 C -> G LOC_Os10g16910.1 upstream_gene_variant ; 3414.0bp to feature; MODIFIER silent_mutation Average:34.648; most accessible tissue: Minghui63 flag leaf, score: 55.781 N N N N
vg1008447547 C -> G LOC_Os10g16900-LOC_Os10g16910 intergenic_region ; MODIFIER silent_mutation Average:34.648; most accessible tissue: Minghui63 flag leaf, score: 55.781 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1008447547 NA 3.93E-06 mr1071 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008447547 NA 7.44E-06 mr1080 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008447547 NA 1.91E-10 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008447547 3.10E-07 8.94E-10 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008447547 5.10E-07 NA mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008447547 1.96E-08 3.58E-12 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008447547 NA 8.09E-07 mr1117 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008447547 1.05E-06 7.00E-18 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008447547 NA 2.71E-09 mr1119 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008447547 NA 2.84E-07 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008447547 NA 2.13E-06 mr1140 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008447547 1.27E-06 1.50E-16 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008447547 3.19E-06 2.06E-10 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008447547 3.17E-08 6.84E-12 mr1247 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008447547 3.34E-06 1.49E-19 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008447547 2.70E-06 1.09E-15 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008447547 NA 3.20E-09 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008447547 NA 1.29E-06 mr1619 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008447547 2.35E-10 2.42E-19 mr1794 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008447547 3.95E-08 1.77E-13 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008447547 5.05E-07 8.58E-09 mr1917 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008447547 NA 2.08E-11 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008447547 NA 3.86E-12 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008447547 6.41E-06 9.05E-10 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008447547 NA 5.06E-18 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008447547 NA 2.92E-09 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008447547 1.55E-06 3.43E-12 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008447547 NA 1.16E-07 mr1183_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008447547 NA 8.97E-11 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008447547 1.08E-06 NA mr1258_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008447547 1.01E-06 1.27E-08 mr1258_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008447547 9.45E-06 7.97E-20 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008447547 NA 5.76E-07 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008447547 NA 6.11E-09 mr1613_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008447547 NA 1.94E-08 mr1619_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008447547 1.38E-06 9.88E-20 mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008447547 NA 5.73E-14 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008447547 NA 1.58E-07 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251