\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1008380500:

Variant ID: vg1008380500 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 8380500
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAGAACCCTAGATAATCATATATGCTATTTCTAATTACAAATCTAATAATATTATATTAAAACTCAAATAATCTTGTATTAAAACTCTAATAATCTTATA[T/A]
TAAAAATCTAATAGTCATATATGCTAAGTCTAAGTGTCGTATATTAGAACCCTAGATAATCATATATGCTAAGTCTAATTACAAATCTAATAATCTTATA

Reverse complement sequence

TATAAGATTATTAGATTTGTAATTAGACTTAGCATATATGATTATCTAGGGTTCTAATATACGACACTTAGACTTAGCATATATGACTATTAGATTTTTA[A/T]
TATAAGATTATTAGAGTTTTAATACAAGATTATTTGAGTTTTAATATAATATTATTAGATTTGTAATTAGAAATAGCATATATGATTATCTAGGGTTCTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.40% 0.20% 8.46% 19.87% NA
All Indica  2759 63.40% 0.00% 3.41% 33.20% NA
All Japonica  1512 98.00% 0.10% 1.52% 0.33% NA
Aus  269 4.50% 2.20% 92.19% 1.12% NA
Indica I  595 86.40% 0.00% 3.87% 9.75% NA
Indica II  465 43.00% 0.00% 0.86% 56.13% NA
Indica III  913 64.50% 0.00% 2.74% 32.75% NA
Indica Intermediate  786 56.70% 0.00% 5.34% 37.91% NA
Temperate Japonica  767 99.60% 0.00% 0.13% 0.26% NA
Tropical Japonica  504 96.00% 0.20% 3.77% 0.00% NA
Japonica Intermediate  241 97.10% 0.40% 1.24% 1.24% NA
VI/Aromatic  96 70.80% 2.10% 26.04% 1.04% NA
Intermediate  90 72.20% 1.10% 11.11% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1008380500 T -> A LOC_Os10g16810.1 upstream_gene_variant ; 2819.0bp to feature; MODIFIER silent_mutation Average:15.705; most accessible tissue: Minghui63 young leaf, score: 22.423 N N N N
vg1008380500 T -> A LOC_Os10g16824.1 intron_variant ; MODIFIER silent_mutation Average:15.705; most accessible tissue: Minghui63 young leaf, score: 22.423 N N N N
vg1008380500 T -> DEL N N silent_mutation Average:15.705; most accessible tissue: Minghui63 young leaf, score: 22.423 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1008380500 6.19E-06 6.18E-06 mr1025 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008380500 NA 3.25E-08 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008380500 NA 2.14E-06 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008380500 NA 8.01E-08 mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008380500 NA 1.43E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008380500 NA 3.10E-06 mr1394 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008380500 NA 9.70E-07 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008380500 NA 8.19E-06 mr1427 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008380500 4.62E-06 4.61E-06 mr1459 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008380500 NA 1.14E-06 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008380500 1.49E-06 NA mr1584 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008380500 NA 2.69E-06 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008380500 NA 7.42E-07 mr1762 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008380500 NA 4.92E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008380500 NA 2.94E-06 mr1820 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008380500 NA 7.47E-07 mr1884 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008380500 NA 1.75E-06 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251