\
| Variant ID: vg1008369782 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 8369782 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CTGCACCTCCCAAGACAAGGTCTCGCCAAGCTCCACCGCCTGCCCGCACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCACCAAAAACAAGGAGCCGCC[G/A]
TACGATTGCAGTCAAGAGGAGCTTGATGCTTATGTGGCAGGAGAAGTGAAGAGGCAACTCAAGCCTCGGAGTCCTGAAAAGAAGATACCTATTGACCCGA
TCGGGTCAATAGGTATCTTCTTTTCAGGACTCCGAGGCTTGAGTTGCCTCTTCACTTCTCCTGCCACATAAGCATCAAGCTCCTCTTGACTGCAATCGTA[C/T]
GGCGGCTCCTTGTTTTTGGTGGCGTCAACTTTCGCCTTCTTCGTTGCCCTTGTGCGGGCAGGCGGTGGAGCTTGGCGAGACCTTGTCTTGGGAGGTGCAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.40% | 6.10% | 0.23% | 0.30% | NA |
| All Indica | 2759 | 99.90% | 0.00% | 0.00% | 0.07% | NA |
| All Japonica | 1512 | 80.20% | 18.50% | 0.66% | 0.66% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.10% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 99.90% | 0.00% | 0.00% | 0.13% | NA |
| Temperate Japonica | 767 | 65.20% | 34.20% | 0.52% | 0.13% | NA |
| Tropical Japonica | 504 | 97.60% | 1.80% | 0.40% | 0.20% | NA |
| Japonica Intermediate | 241 | 91.30% | 3.70% | 1.66% | 3.32% | NA |
| VI/Aromatic | 96 | 95.80% | 3.10% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 3.30% | 0.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1008369782 | G -> A | LOC_Os10g16800.1 | intron_variant ; MODIFIER | silent_mutation | Average:57.895; most accessible tissue: Zhenshan97 flag leaf, score: 74.825 | N | N | N | N |
| vg1008369782 | G -> DEL | N | N | silent_mutation | Average:57.895; most accessible tissue: Zhenshan97 flag leaf, score: 74.825 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1008369782 | 7.84E-08 | NA | mr1300 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008369782 | NA | 9.16E-07 | mr1300 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008369782 | 8.80E-07 | NA | mr1310 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008369782 | NA | 1.23E-06 | mr1310 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008369782 | 3.48E-07 | NA | mr1926 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008369782 | 3.46E-08 | NA | mr1768_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |