\
| Variant ID: vg1008344509 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 8344509 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.68, A: 0.33, others allele: 0.00, population size: 191. )
GAAGTCCTGTGTGCGTTCTTGGCGTATTGCTCTGCGAACTGTTTGTAGACGAAGCAATCTTTGGCCGCGTGGTTGGAGTTGGGATGATGCGGACATTGGG[A/G]
GTTCATGATCTTGTAAGTATTGACGCGGGAACGTTGTCGGGGGGATGGTGTAGTTGTCGCCACAAGTTCCTCGGGCTTATGCTTGCGATCCTTGTGATTG
CAATCACAAGGATCGCAAGCATAAGCCCGAGGAACTTGTGGCGACAACTACACCATCCCCCCGACAACGTTCCCGCGTCAATACTTACAAGATCATGAAC[T/C]
CCCAATGTCCGCATCATCCCAACTCCAACCACGCGGCCAAAGATTGCTTCGTCTACAAACAGTTCGCAGAGCAATACGCCAAGAACGCACACAGGACTTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.10% | 21.20% | 0.42% | 17.27% | NA |
| All Indica | 2759 | 73.70% | 2.90% | 0.65% | 22.73% | NA |
| All Japonica | 1512 | 29.50% | 58.70% | 0.13% | 11.71% | NA |
| Aus | 269 | 98.90% | 0.40% | 0.00% | 0.74% | NA |
| Indica I | 595 | 96.60% | 0.20% | 1.18% | 2.02% | NA |
| Indica II | 465 | 77.80% | 0.60% | 0.43% | 21.08% | NA |
| Indica III | 913 | 53.90% | 6.20% | 0.88% | 38.99% | NA |
| Indica Intermediate | 786 | 76.80% | 2.50% | 0.13% | 20.48% | NA |
| Temperate Japonica | 767 | 7.80% | 87.90% | 0.00% | 4.30% | NA |
| Tropical Japonica | 504 | 68.50% | 14.30% | 0.20% | 17.06% | NA |
| Japonica Intermediate | 241 | 17.00% | 58.50% | 0.41% | 24.07% | NA |
| VI/Aromatic | 96 | 86.50% | 13.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 67.80% | 21.10% | 0.00% | 11.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1008344509 | A -> G | LOC_Os10g16750.1 | missense_variant ; p.Ser468Pro; MODERATE | nonsynonymous_codon ; S468P | Average:28.397; most accessible tissue: Zhenshan97 flag leaf, score: 73.119 | benign |
0.499 |
DELETERIOUS | 0.01 |
| vg1008344509 | A -> DEL | LOC_Os10g16750.1 | N | frameshift_variant | Average:28.397; most accessible tissue: Zhenshan97 flag leaf, score: 73.119 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1008344509 | NA | 1.02E-06 | Awn_length | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1008344509 | NA | 2.06E-07 | mr1113 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008344509 | NA | 1.17E-06 | mr1120 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008344509 | 4.33E-06 | 4.33E-06 | mr1355 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008344509 | NA | 5.48E-06 | mr1619 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008344509 | NA | 3.16E-06 | mr1642 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008344509 | NA | 7.10E-09 | mr1693 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008344509 | NA | 4.32E-06 | mr1842 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008344509 | NA | 3.85E-08 | mr1864 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008344509 | NA | 9.73E-06 | mr1114_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008344509 | NA | 6.92E-07 | mr1120_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008344509 | NA | 3.06E-06 | mr1258_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008344509 | NA | 4.19E-14 | mr1790_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008344509 | NA | 7.42E-07 | mr1991_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |