\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1008310948:

Variant ID: vg1008310948 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 8310948
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 68. )

Flanking Sequence (100 bp) in Reference Genome:


GATCAGAAACAATTGTGTTTGGCACACCATGCAAGCATACAATTTCTCGAAAGAACAGATCAGCGATATGAGAAGCATCATCAGTTTTATGACATGGTAT[G/A]
AAATGTGCCTGTCGGTGACATGGGATCGGGAGTATCATGACTAGAGGTTTGAGGCAGACACAATCGCCCACGTGGCCTGGCACCCTCGGGGGACGTCGGG

Reverse complement sequence

CCCGACGTCCCCCGAGGGTGCCAGGCCACGTGGGCGATTGTGTCTGCCTCAAACCTCTAGTCATGATACTCCCGATCCCATGTCACCGACAGGCACATTT[C/T]
ATACCATGTCATAAAACTGATGATGCTTCTCATATCGCTGATCTGTTCTTTCGAGAAATTGTATGCTTGCATGGTGTGCCAAACACAATTGTTTCTGATC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 27.00% 6.20% 34.77% 32.01% NA
All Indica  2759 15.90% 8.10% 44.55% 31.46% NA
All Japonica  1512 44.20% 4.50% 15.08% 36.18% NA
Aus  269 37.50% 0.70% 42.01% 19.70% NA
Indica I  595 12.60% 0.20% 64.54% 22.69% NA
Indica II  465 16.30% 4.50% 38.71% 40.43% NA
Indica III  913 15.80% 17.20% 34.28% 32.75% NA
Indica Intermediate  786 18.30% 5.60% 44.78% 31.30% NA
Temperate Japonica  767 55.10% 0.90% 3.00% 40.94% NA
Tropical Japonica  504 22.00% 6.30% 34.72% 36.90% NA
Japonica Intermediate  241 56.00% 12.00% 12.45% 19.50% NA
VI/Aromatic  96 37.50% 0.00% 39.58% 22.92% NA
Intermediate  90 33.30% 2.20% 38.89% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1008310948 G -> A LOC_Os10g16640.1 upstream_gene_variant ; 1921.0bp to feature; MODIFIER silent_mutation Average:17.697; most accessible tissue: Callus, score: 25.997 N N N N
vg1008310948 G -> A LOC_Os10g16650.1 upstream_gene_variant ; 331.0bp to feature; MODIFIER silent_mutation Average:17.697; most accessible tissue: Callus, score: 25.997 N N N N
vg1008310948 G -> A LOC_Os10g16660.1 upstream_gene_variant ; 1205.0bp to feature; MODIFIER silent_mutation Average:17.697; most accessible tissue: Callus, score: 25.997 N N N N
vg1008310948 G -> A LOC_Os10g16640.2 upstream_gene_variant ; 1921.0bp to feature; MODIFIER silent_mutation Average:17.697; most accessible tissue: Callus, score: 25.997 N N N N
vg1008310948 G -> A LOC_Os10g16670.1 downstream_gene_variant ; 2281.0bp to feature; MODIFIER silent_mutation Average:17.697; most accessible tissue: Callus, score: 25.997 N N N N
vg1008310948 G -> A LOC_Os10g16650-LOC_Os10g16660 intergenic_region ; MODIFIER silent_mutation Average:17.697; most accessible tissue: Callus, score: 25.997 N N N N
vg1008310948 G -> DEL N N silent_mutation Average:17.697; most accessible tissue: Callus, score: 25.997 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1008310948 NA 1.66E-07 Grain_thickness Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1008310948 NA 6.24E-12 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008310948 3.79E-07 1.25E-11 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008310948 2.25E-07 4.76E-11 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008310948 7.26E-07 NA mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008310948 1.43E-07 8.67E-12 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008310948 7.44E-07 4.07E-16 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008310948 1.82E-11 7.73E-23 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008310948 9.26E-06 8.65E-10 mr1119 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008310948 4.20E-06 3.19E-08 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008310948 NA 1.43E-11 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008310948 NA 1.23E-15 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008310948 NA 6.17E-10 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008310948 6.46E-09 1.01E-12 mr1247 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008310948 2.12E-08 NA mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008310948 3.52E-11 2.76E-25 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008310948 NA 1.01E-06 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008310948 NA 1.34E-07 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008310948 5.42E-06 1.66E-15 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008310948 NA 2.73E-09 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008310948 2.06E-08 7.40E-18 mr1794 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008310948 1.68E-07 1.56E-13 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008310948 NA 9.62E-07 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008310948 6.45E-06 4.16E-08 mr1917 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008310948 NA 2.77E-06 mr1936 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008310948 2.74E-09 2.37E-15 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008310948 8.95E-10 2.39E-16 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008310948 8.54E-08 7.51E-13 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008310948 1.23E-07 1.82E-16 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008310948 2.67E-11 2.13E-23 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008310948 NA 2.78E-06 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008310948 3.41E-07 6.13E-12 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008310948 6.81E-09 4.12E-16 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008310948 9.69E-06 NA mr1161_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008310948 4.11E-06 2.65E-11 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008310948 2.45E-06 NA mr1180_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008310948 4.94E-06 NA mr1183_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008310948 NA 1.39E-09 mr1183_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008310948 2.33E-08 5.68E-15 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008310948 1.25E-09 6.68E-12 mr1258_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008310948 3.55E-09 3.72E-11 mr1258_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008310948 1.66E-10 NA mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008310948 3.14E-13 1.93E-26 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008310948 NA 2.21E-08 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008310948 NA 1.94E-07 mr1619_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008310948 9.45E-11 1.14E-25 mr1794_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008310948 9.53E-09 4.77E-19 mr1794_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008310948 NA 3.07E-06 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008310948 NA 1.48E-06 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008310948 NA 4.72E-07 mr1961_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251