\
| Variant ID: vg1008209441 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 8209441 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 119. )
ACTGACTCCAAGTTGGTAGCAGGCCATGTTGACAAGTCCTTCGAGGCAAAAGAAGAGGGAATGAAGAAGTATCTGGAGGCTGTTCGGTCCATGGAAAAAT[G/A]
CTTCACCGGCATAACGGTCAAACACTTGCCTAGAGACCAGAATGGGGAAACAGACGCCTTGGCGAAATCCACTGCTTGTGGTGGCCCACATTCGCCTGGC
GCCAGGCGAATGTGGGCCACCACAAGCAGTGGATTTCGCCAAGGCGTCTGTTTCCCCATTCTGGTCTCTAGGCAAGTGTTTGACCGTTATGCCGGTGAAG[C/T]
ATTTTTCCATGGACCGAACAGCCTCCAGATACTTCTTCATTCCCTCTTCTTTTGCCTCGAAGGACTTGTCAACATGGCCTGCTACCAACTTGGAGTCAGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.00% | 18.90% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 75.40% | 24.50% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 86.30% | 13.60% | 0.07% | 0.00% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.30% | 1.50% | 0.17% | 0.00% | NA |
| Indica II | 465 | 77.60% | 22.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 56.50% | 43.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 78.60% | 21.10% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 95.30% | 4.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 77.80% | 22.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 75.50% | 24.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1008209441 | G -> A | LOC_Os10g16460.1 | missense_variant ; p.Cys683Tyr; MODERATE | nonsynonymous_codon ; C683Y | Average:42.836; most accessible tissue: Minghui63 flag leaf, score: 61.214 | benign |
0.352 |
TOLERATED | 0.93 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1008209441 | NA | 4.66E-10 | mr1026 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008209441 | NA | 3.41E-07 | mr1113 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008209441 | NA | 3.15E-09 | mr1114 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008209441 | 7.06E-06 | NA | mr1116 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008209441 | 2.49E-06 | 1.39E-10 | mr1116 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008209441 | 3.47E-07 | 8.24E-16 | mr1118 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008209441 | 1.45E-11 | 4.19E-21 | mr1118 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008209441 | NA | 8.90E-07 | mr1123 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008209441 | NA | 4.10E-10 | mr1161 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008209441 | NA | 2.74E-13 | mr1183 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008209441 | NA | 2.77E-08 | mr1183 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008209441 | 2.40E-06 | 2.40E-06 | mr1239 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008209441 | NA | 4.36E-07 | mr1247 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008209441 | 9.55E-09 | NA | mr1495 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008209441 | 2.55E-11 | 1.14E-24 | mr1495 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008209441 | NA | 1.01E-06 | mr1495 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008209441 | NA | 5.72E-07 | mr1496 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008209441 | NA | 2.15E-13 | mr1503 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008209441 | NA | 7.61E-08 | mr1503 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008209441 | 1.62E-07 | 1.46E-15 | mr1794 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008209441 | 1.56E-06 | 1.81E-11 | mr1794 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008209441 | NA | 7.04E-06 | mr1917 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008209441 | NA | 5.94E-08 | mr1936 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008209441 | NA | 8.80E-11 | mr1113_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008209441 | NA | 8.15E-12 | mr1114_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008209441 | NA | 9.47E-09 | mr1117_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008209441 | 6.60E-07 | 5.37E-18 | mr1118_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008209441 | NA | 2.78E-06 | mr1118_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008209441 | NA | 1.06E-08 | mr1119_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008209441 | NA | 3.82E-10 | mr1120_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008209441 | NA | 1.24E-07 | mr1183_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008209441 | NA | 1.65E-09 | mr1247_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008209441 | 2.60E-06 | NA | mr1258_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008209441 | NA | 5.86E-08 | mr1258_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008209441 | 3.45E-07 | NA | mr1495_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008209441 | 1.22E-07 | 1.26E-21 | mr1495_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008209441 | NA | 2.21E-08 | mr1495_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008209441 | 9.95E-06 | 9.57E-20 | mr1794_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008209441 | NA | 7.59E-13 | mr1794_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008209441 | NA | 2.55E-06 | mr1807_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008209441 | NA | 4.67E-07 | mr1936_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |