\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1008207053:

Variant ID: vg1008207053 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 8207053
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.01, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


CAAGATGCGCAGTGAAGGATAATCCAAGTGATTACAAGGGCCGACCCGCCAGGCCAGTTGTCCAAACGGCAGAAGAAGATGCAGATCCGTATGGTCCACA[A/G]
CATCACTTCGGCGGGCGAAGGGGCGCCACAGTACGTGAACCAGCTGATCTCTTTCGGGCCAGAAGACGCCGAAGGAGTCCTGTTCCCGCATCAAGATCCA

Reverse complement sequence

TGGATCTTGATGCGGGAACAGGACTCCTTCGGCGTCTTCTGGCCCGAAAGAGATCAGCTGGTTCACGTACTGTGGCGCCCCTTCGCCCGCCGAAGTGATG[T/C]
TGTGGACCATACGGATCTGCATCTTCTTCTGCCGTTTGGACAACTGGCCTGGCGGGTCGGCCCTTGTAATCACTTGGATTATCCTTCACTGCGCATCTTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.40% 8.60% 0.38% 1.65% NA
All Indica  2759 99.70% 0.20% 0.11% 0.04% NA
All Japonica  1512 68.50% 25.60% 0.86% 5.03% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.00% 0.43% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 99.50% 0.30% 0.13% 0.13% NA
Temperate Japonica  767 41.20% 47.50% 1.69% 9.65% NA
Tropical Japonica  504 98.00% 1.80% 0.00% 0.20% NA
Japonica Intermediate  241 93.80% 5.80% 0.00% 0.41% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 86.70% 10.00% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1008207053 A -> G LOC_Os10g16460.1 missense_variant ; p.Asn8Ser; MODERATE nonsynonymous_codon Average:48.765; most accessible tissue: Minghui63 flag leaf, score: 70.17 benign -0.194 TOLERATED 0.69
vg1008207053 A -> DEL LOC_Os10g16460.1 N frameshift_variant Average:48.765; most accessible tissue: Minghui63 flag leaf, score: 70.17 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1008207053 NA 3.10E-06 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008207053 7.12E-10 3.05E-27 mr1300 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008207053 NA 1.56E-09 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008207053 NA 1.73E-06 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008207053 1.62E-10 1.23E-39 mr1310 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008207053 3.76E-06 3.23E-11 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008207053 NA 6.04E-07 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008207053 3.42E-10 2.81E-41 mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008207053 NA 2.57E-10 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008207053 9.44E-06 4.04E-12 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008207053 NA 1.12E-06 mr1959 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008207053 2.73E-10 4.02E-39 mr1310_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008207053 NA 2.68E-12 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008207053 3.46E-06 NA mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008207053 NA 1.30E-06 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008207053 5.36E-08 9.24E-20 mr1959_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008207053 NA 3.45E-10 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251