\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1008206965:

Variant ID: vg1008206965 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 8206965
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGCGCAAGACCCAAGGCCGTAGCAGGGAGCAACTATCGAAGCACCCCGCGAAGCAGTTCAGGAGCAAACACCCCCAGCCGAACAACGCCAAGATGCGCAG[T/C]
GAAGGATAATCCAAGTGATTACAAGGGCCGACCCGCCAGGCCAGTTGTCCAAACGGCAGAAGAAGATGCAGATCCGTATGGTCCACAACATCACTTCGGC

Reverse complement sequence

GCCGAAGTGATGTTGTGGACCATACGGATCTGCATCTTCTTCTGCCGTTTGGACAACTGGCCTGGCGGGTCGGCCCTTGTAATCACTTGGATTATCCTTC[A/G]
CTGCGCATCTTGGCGTTGTTCGGCTGGGGGTGTTTGCTCCTGAACTGCTTCGCGGGGTGCTTCGATAGTTGCTCCCTGCTACGGCCTTGGGTCTTGCGCG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.40% 8.60% 0.38% 1.63% NA
All Indica  2759 99.70% 0.20% 0.07% 0.04% NA
All Japonica  1512 68.70% 25.50% 0.93% 4.96% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.00% 0.43% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 99.50% 0.40% 0.00% 0.13% NA
Temperate Japonica  767 41.30% 47.20% 1.83% 9.65% NA
Tropical Japonica  504 98.20% 1.80% 0.00% 0.00% NA
Japonica Intermediate  241 93.80% 5.80% 0.00% 0.41% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 87.80% 8.90% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1008206965 T -> C LOC_Os10g16460.1 upstream_gene_variant ; 66.0bp to feature; MODIFIER silent_mutation Average:52.134; most accessible tissue: Minghui63 flag leaf, score: 74.161 N N N N
vg1008206965 T -> C LOC_Os10g16450.1 downstream_gene_variant ; 309.0bp to feature; MODIFIER silent_mutation Average:52.134; most accessible tissue: Minghui63 flag leaf, score: 74.161 N N N N
vg1008206965 T -> C LOC_Os10g16470.1 downstream_gene_variant ; 4521.0bp to feature; MODIFIER silent_mutation Average:52.134; most accessible tissue: Minghui63 flag leaf, score: 74.161 N N N N
vg1008206965 T -> C LOC_Os10g16450-LOC_Os10g16460 intergenic_region ; MODIFIER silent_mutation Average:52.134; most accessible tissue: Minghui63 flag leaf, score: 74.161 N N N N
vg1008206965 T -> DEL N N silent_mutation Average:52.134; most accessible tissue: Minghui63 flag leaf, score: 74.161 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1008206965 NA 4.37E-06 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008206965 3.39E-09 3.98E-25 mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008206965 7.06E-06 1.09E-09 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008206965 NA 1.09E-06 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008206965 2.16E-09 2.62E-35 mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008206965 1.19E-06 1.56E-11 mr1310 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008206965 NA 8.37E-07 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008206965 7.16E-09 NA mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008206965 NA 3.03E-10 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008206965 NA 1.99E-10 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008206965 NA 4.68E-07 mr1959 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008206965 5.66E-09 1.88E-34 mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008206965 4.97E-06 5.42E-13 mr1310_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008206965 4.94E-06 NA mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008206965 NA 2.74E-06 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008206965 8.85E-07 1.09E-17 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008206965 3.81E-06 9.29E-11 mr1959_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251