Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1008206965:

Variant ID: vg1008206965 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 8206965
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGCGCAAGACCCAAGGCCGTAGCAGGGAGCAACTATCGAAGCACCCCGCGAAGCAGTTCAGGAGCAAACACCCCCAGCCGAACAACGCCAAGATGCGCAG[T/C]
GAAGGATAATCCAAGTGATTACAAGGGCCGACCCGCCAGGCCAGTTGTCCAAACGGCAGAAGAAGATGCAGATCCGTATGGTCCACAACATCACTTCGGC

Reverse complement sequence

GCCGAAGTGATGTTGTGGACCATACGGATCTGCATCTTCTTCTGCCGTTTGGACAACTGGCCTGGCGGGTCGGCCCTTGTAATCACTTGGATTATCCTTC[A/G]
CTGCGCATCTTGGCGTTGTTCGGCTGGGGGTGTTTGCTCCTGAACTGCTTCGCGGGGTGCTTCGATAGTTGCTCCCTGCTACGGCCTTGGGTCTTGCGCG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.40%	8.60%	0.38%	1.63%	NA
All Indica	2759	99.70%	0.20%	0.07%	0.04%	NA
All Japonica	1512	68.70%	25.50%	0.93%	4.96%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.60%	0.00%	0.43%	0.00%	NA
Indica III	913	99.70%	0.30%	0.00%	0.00%	NA
Indica Intermediate	786	99.50%	0.40%	0.00%	0.13%	NA
Temperate Japonica	767	41.30%	47.20%	1.83%	9.65%	NA
Tropical Japonica	504	98.20%	1.80%	0.00%	0.00%	NA
Japonica Intermediate	241	93.80%	5.80%	0.00%	0.41%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	87.80%	8.90%	2.22%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1008206965	T -> C	LOC_Os10g16460.1	upstream_gene_variant ; 66.0bp to feature; MODIFIER	silent_mutation	Average:52.134; most accessible tissue: Minghui63 flag leaf, score: 74.161	N	N	N	N
vg1008206965	T -> C	LOC_Os10g16450.1	downstream_gene_variant ; 309.0bp to feature; MODIFIER	silent_mutation	Average:52.134; most accessible tissue: Minghui63 flag leaf, score: 74.161	N	N	N	N
vg1008206965	T -> C	LOC_Os10g16470.1	downstream_gene_variant ; 4521.0bp to feature; MODIFIER	silent_mutation	Average:52.134; most accessible tissue: Minghui63 flag leaf, score: 74.161	N	N	N	N
vg1008206965	T -> C	LOC_Os10g16450-LOC_Os10g16460	intergenic_region ; MODIFIER	silent_mutation	Average:52.134; most accessible tissue: Minghui63 flag leaf, score: 74.161	N	N	N	N
vg1008206965	T -> DEL	N	N	silent_mutation	Average:52.134; most accessible tissue: Minghui63 flag leaf, score: 74.161	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1008206965	NA	4.37E-06	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008206965	3.39E-09	3.98E-25	mr1300	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008206965	7.06E-06	1.09E-09	mr1300	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008206965	NA	1.09E-06	mr1305	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008206965	2.16E-09	2.62E-35	mr1310	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008206965	1.19E-06	1.56E-11	mr1310	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008206965	NA	8.37E-07	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008206965	7.16E-09	NA	mr1926	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008206965	NA	3.03E-10	mr1926	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008206965	NA	1.99E-10	mr1959	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008206965	NA	4.68E-07	mr1959	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008206965	5.66E-09	1.88E-34	mr1310_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008206965	4.97E-06	5.42E-13	mr1310_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008206965	4.94E-06	NA	mr1484_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008206965	NA	2.74E-06	mr1585_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008206965	8.85E-07	1.09E-17	mr1959_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008206965	3.81E-06	9.29E-11	mr1959_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251