\
| Variant ID: vg1008205727 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 8205727 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GAATACAAGTCAAGGTACGCTTAATTGGTTGCCACCGATTCAGCCGGGCCTGGGAGTTTCGCCGTGGAATCAAGGACCGTAGTTCGATTTTGTCAACGCC[A/G]
CTCAGGCGCCAACCGTTCGGCAGTAGGCTCCGACTCCAGGCTTCGGAGCAAACCAAGCACCAATTCAAGCTGCCATGACGTGGTCACAGCTAATTTTTGA
TCAAAAATTAGCTGTGACCACGTCATGGCAGCTTGAATTGGTGCTTGGTTTGCTCCGAAGCCTGGAGTCGGAGCCTACTGCCGAACGGTTGGCGCCTGAG[T/C]
GGCGTTGACAAAATCGAACTACGGTCCTTGATTCCACGGCGAAACTCCCAGGCCCGGCTGAATCGGTGGCAACCAATTAAGCGTACCTTGACTTGTATTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.20% | 9.10% | 2.24% | 1.40% | NA |
| All Indica | 2759 | 99.20% | 0.70% | 0.04% | 0.07% | NA |
| All Japonica | 1512 | 62.60% | 26.70% | 6.61% | 4.10% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.60% | 1.10% | 0.00% | 0.25% | NA |
| Temperate Japonica | 767 | 48.10% | 31.30% | 12.65% | 7.95% | NA |
| Tropical Japonica | 504 | 91.90% | 8.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 47.70% | 50.60% | 1.24% | 0.41% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 10.00% | 4.44% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1008205727 | A -> G | LOC_Os10g16460.1 | upstream_gene_variant ; 1304.0bp to feature; MODIFIER | silent_mutation | Average:53.824; most accessible tissue: Minghui63 flag leaf, score: 75.722 | N | N | N | N |
| vg1008205727 | A -> G | LOC_Os10g16440.1 | downstream_gene_variant ; 4655.0bp to feature; MODIFIER | silent_mutation | Average:53.824; most accessible tissue: Minghui63 flag leaf, score: 75.722 | N | N | N | N |
| vg1008205727 | A -> G | LOC_Os10g16440.2 | downstream_gene_variant ; 4655.0bp to feature; MODIFIER | silent_mutation | Average:53.824; most accessible tissue: Minghui63 flag leaf, score: 75.722 | N | N | N | N |
| vg1008205727 | A -> G | LOC_Os10g16450.1 | intron_variant ; MODIFIER | silent_mutation | Average:53.824; most accessible tissue: Minghui63 flag leaf, score: 75.722 | N | N | N | N |
| vg1008205727 | A -> DEL | N | N | silent_mutation | Average:53.824; most accessible tissue: Minghui63 flag leaf, score: 75.722 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1008205727 | 2.52E-07 | NA | mr1238 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008205727 | 2.11E-07 | NA | mr1238_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008205727 | 7.40E-08 | NA | mr1484_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008205727 | 1.23E-08 | NA | mr1841_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008205727 | 8.08E-07 | NA | mr1900_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008205727 | 4.22E-06 | NA | mr1945_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |