\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1008205727:

Variant ID: vg1008205727 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 8205727
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAATACAAGTCAAGGTACGCTTAATTGGTTGCCACCGATTCAGCCGGGCCTGGGAGTTTCGCCGTGGAATCAAGGACCGTAGTTCGATTTTGTCAACGCC[A/G]
CTCAGGCGCCAACCGTTCGGCAGTAGGCTCCGACTCCAGGCTTCGGAGCAAACCAAGCACCAATTCAAGCTGCCATGACGTGGTCACAGCTAATTTTTGA

Reverse complement sequence

TCAAAAATTAGCTGTGACCACGTCATGGCAGCTTGAATTGGTGCTTGGTTTGCTCCGAAGCCTGGAGTCGGAGCCTACTGCCGAACGGTTGGCGCCTGAG[T/C]
GGCGTTGACAAAATCGAACTACGGTCCTTGATTCCACGGCGAAACTCCCAGGCCCGGCTGAATCGGTGGCAACCAATTAAGCGTACCTTGACTTGTATTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.20% 9.10% 2.24% 1.40% NA
All Indica  2759 99.20% 0.70% 0.04% 0.07% NA
All Japonica  1512 62.60% 26.70% 6.61% 4.10% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 99.60% 0.20% 0.22% 0.00% NA
Indica III  913 99.20% 0.80% 0.00% 0.00% NA
Indica Intermediate  786 98.60% 1.10% 0.00% 0.25% NA
Temperate Japonica  767 48.10% 31.30% 12.65% 7.95% NA
Tropical Japonica  504 91.90% 8.10% 0.00% 0.00% NA
Japonica Intermediate  241 47.70% 50.60% 1.24% 0.41% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 83.30% 10.00% 4.44% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1008205727 A -> G LOC_Os10g16460.1 upstream_gene_variant ; 1304.0bp to feature; MODIFIER silent_mutation Average:53.824; most accessible tissue: Minghui63 flag leaf, score: 75.722 N N N N
vg1008205727 A -> G LOC_Os10g16440.1 downstream_gene_variant ; 4655.0bp to feature; MODIFIER silent_mutation Average:53.824; most accessible tissue: Minghui63 flag leaf, score: 75.722 N N N N
vg1008205727 A -> G LOC_Os10g16440.2 downstream_gene_variant ; 4655.0bp to feature; MODIFIER silent_mutation Average:53.824; most accessible tissue: Minghui63 flag leaf, score: 75.722 N N N N
vg1008205727 A -> G LOC_Os10g16450.1 intron_variant ; MODIFIER silent_mutation Average:53.824; most accessible tissue: Minghui63 flag leaf, score: 75.722 N N N N
vg1008205727 A -> DEL N N silent_mutation Average:53.824; most accessible tissue: Minghui63 flag leaf, score: 75.722 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1008205727 2.52E-07 NA mr1238 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008205727 2.11E-07 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008205727 7.40E-08 NA mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008205727 1.23E-08 NA mr1841_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008205727 8.08E-07 NA mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008205727 4.22E-06 NA mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251