| Variant ID: vg1008205459 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 8205459 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GGACCAAGGCCATGTCGGCTCCAATCCTTCAGTATTCGGCAGGCTATGTCCCACCTCAAGTCCATCCGCAAGTAACGGCCCAGCCCTTTCCGCCACAAGC[T/C]
GCACAAGCGCCGGTGTACTTCGCCGGGCAGCATCAACCACCTGGCCAAGCGCCAAAATTAGTGGCGGAAGGGGCTTTGGCTCTGCAGGCGCAACTCCAAG
CTTGGAGTTGCGCCTGCAGAGCCAAAGCCCCTTCCGCCACTAATTTTGGCGCTTGGCCAGGTGGTTGATGCTGCCCGGCGAAGTACACCGGCGCTTGTGC[A/G]
GCTTGTGGCGGAAAGGGCTGGGCCGTTACTTGCGGATGGACTTGAGGTGGGACATAGCCTGCCGAATACTGAAGGATTGGAGCCGACATGGCCTTGGTCC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.40% | 8.70% | 0.59% | 1.31% | NA |
| All Indica | 2759 | 99.70% | 0.20% | 0.07% | 0.04% | NA |
| All Japonica | 1512 | 68.60% | 25.90% | 1.59% | 3.97% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.40% | 0.30% | 0.25% | 0.13% | NA |
| Temperate Japonica | 767 | 41.30% | 47.80% | 3.13% | 7.69% | NA |
| Tropical Japonica | 504 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 93.40% | 6.20% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 7.80% | 2.22% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1008205459 | T -> C | LOC_Os10g16450.1 | synonymous_variant ; p.Ala63Ala; LOW | synonymous_codon | Average:70.724; most accessible tissue: Minghui63 flag leaf, score: 87.052 | N | N | N | N |
| vg1008205459 | T -> DEL | LOC_Os10g16450.1 | N | frameshift_variant | Average:70.724; most accessible tissue: Minghui63 flag leaf, score: 87.052 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1008205459 | NA | 2.30E-06 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008205459 | 4.49E-10 | 9.02E-27 | mr1300 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008205459 | 2.16E-06 | 1.98E-10 | mr1300 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008205459 | NA | 1.16E-06 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008205459 | 5.73E-10 | 4.71E-37 | mr1310 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008205459 | 1.28E-06 | 1.07E-11 | mr1310 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008205459 | NA | 3.18E-07 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008205459 | NA | 7.94E-06 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008205459 | 2.46E-10 | NA | mr1926 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008205459 | NA | 9.22E-11 | mr1926 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/