\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1008205459:

Variant ID: vg1008205459 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 8205459
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGACCAAGGCCATGTCGGCTCCAATCCTTCAGTATTCGGCAGGCTATGTCCCACCTCAAGTCCATCCGCAAGTAACGGCCCAGCCCTTTCCGCCACAAGC[T/C]
GCACAAGCGCCGGTGTACTTCGCCGGGCAGCATCAACCACCTGGCCAAGCGCCAAAATTAGTGGCGGAAGGGGCTTTGGCTCTGCAGGCGCAACTCCAAG

Reverse complement sequence

CTTGGAGTTGCGCCTGCAGAGCCAAAGCCCCTTCCGCCACTAATTTTGGCGCTTGGCCAGGTGGTTGATGCTGCCCGGCGAAGTACACCGGCGCTTGTGC[A/G]
GCTTGTGGCGGAAAGGGCTGGGCCGTTACTTGCGGATGGACTTGAGGTGGGACATAGCCTGCCGAATACTGAAGGATTGGAGCCGACATGGCCTTGGTCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.40% 8.70% 0.59% 1.31% NA
All Indica  2759 99.70% 0.20% 0.07% 0.04% NA
All Japonica  1512 68.60% 25.90% 1.59% 3.97% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 99.40% 0.30% 0.25% 0.13% NA
Temperate Japonica  767 41.30% 47.80% 3.13% 7.69% NA
Tropical Japonica  504 98.20% 1.80% 0.00% 0.00% NA
Japonica Intermediate  241 93.40% 6.20% 0.00% 0.41% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 88.90% 7.80% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1008205459 T -> C LOC_Os10g16450.1 synonymous_variant ; p.Ala63Ala; LOW synonymous_codon Average:70.724; most accessible tissue: Minghui63 flag leaf, score: 87.052 N N N N
vg1008205459 T -> DEL LOC_Os10g16450.1 N frameshift_variant Average:70.724; most accessible tissue: Minghui63 flag leaf, score: 87.052 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1008205459 NA 2.30E-06 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008205459 4.49E-10 9.02E-27 mr1300 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008205459 2.16E-06 1.98E-10 mr1300 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008205459 NA 1.16E-06 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008205459 5.73E-10 4.71E-37 mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008205459 1.28E-06 1.07E-11 mr1310 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008205459 NA 3.18E-07 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008205459 NA 7.94E-06 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008205459 2.46E-10 NA mr1926 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008205459 NA 9.22E-11 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008205459 NA 1.38E-11 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008205459 NA 2.98E-07 mr1959 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008205459 5.37E-10 5.30E-37 mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008205459 7.72E-06 2.85E-13 mr1310_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008205459 NA 5.53E-07 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008205459 8.34E-07 1.78E-18 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008205459 8.30E-06 1.30E-10 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251