\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1008185143:

Variant ID: vg1008185143 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 8185143
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.75, C: 0.25, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:


CTAAAGTCCTCCCTGTCCGGATATGCAGTAGAATGACATCTGTGAGCAGCGGGCTGGCCAGTGCCTGAAGTATCGTGTTAGAATTAAACTGAGCATTCCG[T/C]
AGACACTCTTTCTCACTAGGAAATCCTCTCTACCCTTTGCCTAATTTGCTTCGTGTCCTTGGATGAGCCGGAAGAGGAGCTGAACACACACGTTCCCTGA

Reverse complement sequence

TCAGGGAACGTGTGTGTTCAGCTCCTCTTCCGGCTCATCCAAGGACACGAAGCAAATTAGGCAAAGGGTAGAGAGGATTTCCTAGTGAGAAAGAGTGTCT[A/G]
CGGAATGCTCAGTTTAATTCTAACACGATACTTCAGGCACTGGCCAGCCCGCTGCTCACAGATGTCATTCTACTGCATATCCGGACAGGGAGGACTTTAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.30% 16.00% 0.40% 3.28% NA
All Indica  2759 98.90% 0.90% 0.04% 0.07% NA
All Japonica  1512 43.20% 46.70% 0.26% 9.85% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 99.40% 0.40% 0.00% 0.22% NA
Indica III  913 98.90% 1.10% 0.00% 0.00% NA
Indica Intermediate  786 98.30% 1.40% 0.13% 0.13% NA
Temperate Japonica  767 12.90% 67.50% 0.39% 19.17% NA
Tropical Japonica  504 89.90% 9.90% 0.20% 0.00% NA
Japonica Intermediate  241 41.90% 57.30% 0.00% 0.83% NA
VI/Aromatic  96 78.10% 8.30% 13.54% 0.00% NA
Intermediate  90 76.70% 17.80% 1.11% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1008185143 T -> C LOC_Os10g16410.1 downstream_gene_variant ; 4208.0bp to feature; MODIFIER silent_mutation Average:66.018; most accessible tissue: Minghui63 flag leaf, score: 85.327 N N N N
vg1008185143 T -> C LOC_Os10g16410-LOC_Os10g16430 intergenic_region ; MODIFIER silent_mutation Average:66.018; most accessible tissue: Minghui63 flag leaf, score: 85.327 N N N N
vg1008185143 T -> DEL N N silent_mutation Average:66.018; most accessible tissue: Minghui63 flag leaf, score: 85.327 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1008185143 T C 0.0 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1008185143 NA 2.73E-09 mr1624 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008185143 NA 2.06E-24 mr1679 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008185143 NA 3.52E-09 mr1679 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008185143 NA 1.28E-10 mr1691 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008185143 NA 2.03E-10 mr1693 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008185143 NA 7.19E-07 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008185143 4.83E-06 NA mr1519_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008185143 NA 3.07E-09 mr1624_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008185143 NA 4.50E-23 mr1679_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008185143 NA 1.16E-07 mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008185143 NA 2.31E-07 mr1733_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251