\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1008185116:

Variant ID: vg1008185116 (JBrowse)Variation Type: INDEL
Chromosome: chr10Position: 8185116
Reference Allele: CGTGTTAGAAlternative Allele: TGTGTTAGA,C
Primary Allele: TGTGTTAGASecondary Allele: CGTGTTAGA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAGAGGTGGTAACAACCCTCAATTACACTAAAGTCCTCCCTGTCCGGATATGCAGTAGAATGACATCTGTGAGCAGCGGGCTGGCCAGTGCCTGAAGTAT[CGTGTTAGA/TGTGTTAGA,C]
ATTAAACTGAGCATTCCGTAGACACTCTTTCTCACTAGGAAATCCTCTCTACCCTTTGCCTAATTTGCTTCGTGTCCTTGGATGAGCCGGAAGAGGAGCT

Reverse complement sequence

AGCTCCTCTTCCGGCTCATCCAAGGACACGAAGCAAATTAGGCAAAGGGTAGAGAGGATTTCCTAGTGAGAAAGAGTGTCTACGGAATGCTCAGTTTAAT[TCTAACACG/TCTAACACA,G]
ATACTTCAGGCACTGGCCAGCCCGCTGCTCACAGATGTCATTCTACTGCATATCCGGACAGGGAGGACTTTAGTGTAATTGAGGGTTGTTACCACCTCTA

Allele Frequencies:

Populations Population SizeFrequency of TGTGTTAGA(primary allele) Frequency of CGTGTTAGA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.60% 31.60% 0.53% 3.20% C: 0.08%
All Indica  2759 95.70% 4.20% 0.04% 0.07% C: 0.04%
All Japonica  1512 23.70% 65.90% 0.53% 9.72% C: 0.13%
Aus  269 1.90% 98.10% 0.00% 0.00% NA
Indica I  595 98.20% 1.80% 0.00% 0.00% NA
Indica II  465 98.30% 1.50% 0.00% 0.22% NA
Indica III  913 94.70% 5.30% 0.00% 0.00% NA
Indica Intermediate  786 93.30% 6.40% 0.13% 0.13% C: 0.13%
Temperate Japonica  767 6.80% 73.00% 0.91% 19.04% C: 0.26%
Tropical Japonica  504 45.80% 54.00% 0.20% 0.00% NA
Japonica Intermediate  241 31.10% 68.50% 0.00% 0.41% NA
VI/Aromatic  96 7.30% 77.10% 14.58% 0.00% C: 1.04%
Intermediate  90 46.70% 48.90% 2.22% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1008185116 CGTGTTAGA -> DEL N N silent_mutation Average:66.514; most accessible tissue: Minghui63 flag leaf, score: 84.973 N N N N
vg1008185116 CGTGTTAGA -> C LOC_Os10g16410.1 downstream_gene_variant ; 4182.0bp to feature; MODIFIER silent_mutation Average:66.514; most accessible tissue: Minghui63 flag leaf, score: 84.973 N N N N
vg1008185116 CGTGTTAGA -> C LOC_Os10g16410-LOC_Os10g16430 intergenic_region ; MODIFIER silent_mutation Average:66.514; most accessible tissue: Minghui63 flag leaf, score: 84.973 N N N N
vg1008185116 CGTGTTAGA -> TGTGTTAGA LOC_Os10g16410.1 downstream_gene_variant ; 4181.0bp to feature; MODIFIER silent_mutation Average:66.514; most accessible tissue: Minghui63 flag leaf, score: 84.973 N N N N
vg1008185116 CGTGTTAGA -> TGTGTTAGA LOC_Os10g16410-LOC_Os10g16430 intergenic_region ; MODIFIER silent_mutation Average:66.514; most accessible tissue: Minghui63 flag leaf, score: 84.973 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1008185116 CGTGT* C -0.02 -0.02 0.01 -0.05 0.0 0.0
vg1008185116 CGTGT* TGTGT* 0.0 0.01 0.01 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1008185116 NA 6.49E-14 mr1180 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008185116 NA 5.00E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008185116 NA 1.53E-18 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008185116 NA 3.95E-07 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008185116 NA 2.23E-10 mr1260 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008185116 NA 7.73E-19 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008185116 NA 7.95E-08 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008185116 NA 2.07E-17 mr1583 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008185116 NA 5.27E-13 mr1794 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008185116 NA 4.92E-06 mr1794 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008185116 NA 9.86E-09 mr1929 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008185116 NA 5.28E-24 mr1180_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008185116 NA 2.31E-07 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008185116 NA 8.86E-28 mr1183_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008185116 NA 8.10E-08 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008185116 NA 5.74E-19 mr1260_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008185116 NA 4.44E-12 mr1409_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008185116 NA 1.02E-07 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008185116 NA 7.77E-07 mr1548_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008185116 NA 4.49E-15 mr1583_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008185116 NA 1.84E-10 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008185116 NA 4.37E-15 mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008185116 NA 7.38E-13 mr1850_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251