Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1008183244:

Variant ID: vg1008183244 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 8183244
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:

AAAGCTCTCTCATATTCTCTCAAGTTCAGTATAGTAGTCTTAAGCTAATGGAGTAGGAATAGAATAGAAATCAGAGTCCGGAAGCCTTCGGAAGAGTTCA[G/A]
GTATGGCTCTAGTAGCTTTCCTTTTCTCTTTTGTAAGCTCTGTACTTTTATTAGAATACTCTTTATACATTTATGGTATTGAAATACTTTCCGAGTATAT

Reverse complement sequence

ATATACTCGGAAAGTATTTCAATACCATAAATGTATAAAGAGTATTCTAATAAAAGTACAGAGCTTACAAAAGAGAAAAGGAAAGCTACTAGAGCCATAC[C/T]
TGAACTCTTCCGAAGGCTTCCGGACTCTGATTTCTATTCTATTCCTACTCCATTAGCTTAAGACTACTATACTGAACTTGAGAGAATATGAGAGAGCTTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.20%	24.00%	0.36%	3.43%	NA
All Indica	2759	64.80%	35.10%	0.04%	0.11%	NA
All Japonica	1512	80.30%	9.30%	0.20%	10.19%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	13.60%	86.20%	0.17%	0.00%	NA
Indica II	465	83.90%	15.90%	0.00%	0.22%	NA
Indica III	913	84.70%	15.30%	0.00%	0.00%	NA
Indica Intermediate	786	69.10%	30.70%	0.00%	0.25%	NA
Temperate Japonica	767	78.50%	1.60%	0.26%	19.69%	NA
Tropical Japonica	504	76.20%	23.60%	0.20%	0.00%	NA
Japonica Intermediate	241	94.60%	4.10%	0.00%	1.24%	NA
VI/Aromatic	96	80.20%	7.30%	12.50%	0.00%	NA
Intermediate	90	74.40%	18.90%	1.11%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1008183244	G -> A	LOC_Os10g16410.1	downstream_gene_variant ; 2309.0bp to feature; MODIFIER	silent_mutation	Average:44.529; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg1008183244	G -> A	LOC_Os10g16410-LOC_Os10g16430	intergenic_region ; MODIFIER	silent_mutation	Average:44.529; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg1008183244	G -> DEL	N	N	silent_mutation	Average:44.529; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1008183244	NA	1.23E-33	mr1026	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008183244	2.04E-06	3.23E-20	mr1026	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008183244	NA	4.87E-08	mr1113	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008183244	NA	6.27E-08	mr1114	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008183244	8.43E-06	2.95E-07	mr1116	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008183244	6.87E-09	8.23E-21	mr1118	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008183244	NA	7.97E-07	mr1120	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008183244	5.55E-06	1.21E-18	mr1161	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008183244	7.45E-11	1.51E-26	mr1495	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008183244	NA	1.48E-09	mr1496	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008183244	NA	7.72E-07	mr1789	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008183244	5.06E-06	8.21E-12	mr1794	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008183244	NA	7.30E-06	mr1936	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008183244	NA	6.23E-06	mr1114_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008183244	NA	3.42E-17	mr1118_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008183244	6.15E-10	1.01E-27	mr1118_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008183244	NA	5.60E-08	mr1120_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008183244	NA	4.79E-08	mr1123_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008183244	7.43E-09	1.94E-36	mr1161_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008183244	1.15E-08	1.12E-21	mr1161_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008183244	6.08E-07	1.80E-24	mr1495_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008183244	1.26E-11	3.65E-31	mr1495_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008183244	NA	1.23E-10	mr1496_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008183244	NA	3.50E-07	mr1531_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008183244	5.41E-07	NA	mr1580_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008183244	NA	5.65E-15	mr1794_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008183244	3.13E-07	NA	mr1825_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008183244	NA	1.07E-11	mr1936_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251