\
| Variant ID: vg1008069058 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 8069058 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 204. )
GTGGGTGACTTCATGTTCTTGATTGCCTTGATCTTCTCGGGATTTGCTTCTATTCCTCTTCCAGAGACAAGGAACCCGAGCAGCTTGCCCGATGGTACTC[C/T]
GAACGTGCACTTCTCTGGATTGAGTATGAGGCAATATCGTCGGAGGTTGTCGAACGTTTCCCGCAGATCGTCAATCAATGAGTCGCTTGTCTTGATCTTG
CAAGATCAAGACAAGCGACTCATTGATTGACGATCTGCGGGAAACGTTCGACAACCTCCGACGATATTGCCTCATACTCAATCCAGAGAAGTGCACGTTC[G/A]
GAGTACCATCGGGCAAGCTGCTCGGGTTCCTTGTCTCTGGAAGAGGAATAGAAGCAAATCCCGAGAAGATCAAGGCAATCAAGAACATGAAGTCACCCAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.40% | 0.50% | 2.64% | 25.41% | NA |
| All Indica | 2759 | 77.10% | 0.20% | 3.15% | 19.61% | NA |
| All Japonica | 1512 | 70.50% | 0.00% | 1.39% | 28.11% | NA |
| Aus | 269 | 20.80% | 6.30% | 4.46% | 68.40% | NA |
| Indica I | 595 | 98.00% | 0.00% | 0.00% | 2.02% | NA |
| Indica II | 465 | 81.90% | 0.00% | 2.80% | 15.27% | NA |
| Indica III | 913 | 59.90% | 0.20% | 4.93% | 34.94% | NA |
| Indica Intermediate | 786 | 78.20% | 0.40% | 3.69% | 17.68% | NA |
| Temperate Japonica | 767 | 74.40% | 0.00% | 1.69% | 23.86% | NA |
| Tropical Japonica | 504 | 62.70% | 0.00% | 1.19% | 36.11% | NA |
| Japonica Intermediate | 241 | 74.30% | 0.00% | 0.83% | 24.90% | NA |
| VI/Aromatic | 96 | 63.50% | 0.00% | 4.17% | 32.29% | NA |
| Intermediate | 90 | 74.40% | 2.20% | 1.11% | 22.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1008069058 | C -> T | LOC_Os10g15170.1 | missense_variant ; p.Gly151Arg; MODERATE | nonsynonymous_codon ; G151R | Average:33.324; most accessible tissue: Zhenshan97 panicle, score: 75.67 | benign |
1.041 |
DELETERIOUS | 0.04 |
| vg1008069058 | C -> DEL | LOC_Os10g15170.1 | N | frameshift_variant | Average:33.324; most accessible tissue: Zhenshan97 panicle, score: 75.67 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1008069058 | NA | 4.82E-10 | mr1040 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008069058 | NA | 1.95E-13 | mr1362 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008069058 | NA | 8.45E-16 | mr1040_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008069058 | NA | 2.68E-14 | mr1790_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008069058 | NA | 1.67E-17 | mr1836_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008069058 | NA | 2.68E-09 | mr1947_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |