\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1008033341:

Variant ID: vg1008033341 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 8033341
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAGGGAAGATTTGGTCCAATCCAGATTGAAAGGATTGCTAAGCATTATAACAAGATGGTAGTCCCTAAGTCTTTTTCTGAAGGAGAGTTTGTTTGGAAG[C/T]
TGATCTTGCCGATAGGAACTCGAGATAACAAATTCGGCAAGTGGTCACCGAATTGGGAAGGACCATTTCAAATCCATAAGGTTGTGTCCAAAGGAGCTTA

Reverse complement sequence

TAAGCTCCTTTGGACACAACCTTATGGATTTGAAATGGTCCTTCCCAATTCGGTGACCACTTGCCGAATTTGTTATCTCGAGTTCCTATCGGCAAGATCA[G/A]
CTTCCAAACAAACTCTCCTTCAGAAAAAGACTTAGGGACTACCATCTTGTTATAATGCTTAGCAATCCTTTCAATCTGGATTGGACCAAATCTTCCCTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.50% 0.30% 1.35% 10.83% NA
All Indica  2759 81.60% 0.50% 2.28% 15.55% NA
All Japonica  1512 99.50% 0.00% 0.07% 0.40% NA
Aus  269 73.20% 0.00% 0.00% 26.77% NA
Indica I  595 96.10% 0.00% 1.85% 2.02% NA
Indica II  465 72.00% 0.20% 2.58% 25.16% NA
Indica III  913 74.30% 1.20% 3.29% 21.25% NA
Indica Intermediate  786 84.90% 0.40% 1.27% 13.49% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 98.60% 0.00% 0.20% 1.19% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 95.60% 0.00% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1008033341 C -> T LOC_Os10g15250.1 downstream_gene_variant ; 39.0bp to feature; MODIFIER silent_mutation Average:25.701; most accessible tissue: Callus, score: 52.905 N N N N
vg1008033341 C -> T LOC_Os10g15240.1 downstream_gene_variant ; 636.0bp to feature; MODIFIER silent_mutation Average:25.701; most accessible tissue: Callus, score: 52.905 N N N N
vg1008033341 C -> T LOC_Os10g15250-LOC_Os10g15240 intergenic_region ; MODIFIER silent_mutation Average:25.701; most accessible tissue: Callus, score: 52.905 N N N N
vg1008033341 C -> DEL N N silent_mutation Average:25.701; most accessible tissue: Callus, score: 52.905 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1008033341 9.83E-07 NA mr1110 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008033341 NA 2.20E-12 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008033341 NA 4.80E-10 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008033341 NA 1.87E-12 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008033341 NA 7.87E-08 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008033341 NA 4.41E-06 mr1936 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008033341 NA 1.14E-09 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251