\
| Variant ID: vg1008033341 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 8033341 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AAAGGGAAGATTTGGTCCAATCCAGATTGAAAGGATTGCTAAGCATTATAACAAGATGGTAGTCCCTAAGTCTTTTTCTGAAGGAGAGTTTGTTTGGAAG[C/T]
TGATCTTGCCGATAGGAACTCGAGATAACAAATTCGGCAAGTGGTCACCGAATTGGGAAGGACCATTTCAAATCCATAAGGTTGTGTCCAAAGGAGCTTA
TAAGCTCCTTTGGACACAACCTTATGGATTTGAAATGGTCCTTCCCAATTCGGTGACCACTTGCCGAATTTGTTATCTCGAGTTCCTATCGGCAAGATCA[G/A]
CTTCCAAACAAACTCTCCTTCAGAAAAAGACTTAGGGACTACCATCTTGTTATAATGCTTAGCAATCCTTTCAATCTGGATTGGACCAAATCTTCCCTTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.50% | 0.30% | 1.35% | 10.83% | NA |
| All Indica | 2759 | 81.60% | 0.50% | 2.28% | 15.55% | NA |
| All Japonica | 1512 | 99.50% | 0.00% | 0.07% | 0.40% | NA |
| Aus | 269 | 73.20% | 0.00% | 0.00% | 26.77% | NA |
| Indica I | 595 | 96.10% | 0.00% | 1.85% | 2.02% | NA |
| Indica II | 465 | 72.00% | 0.20% | 2.58% | 25.16% | NA |
| Indica III | 913 | 74.30% | 1.20% | 3.29% | 21.25% | NA |
| Indica Intermediate | 786 | 84.90% | 0.40% | 1.27% | 13.49% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.60% | 0.00% | 0.20% | 1.19% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 95.60% | 0.00% | 0.00% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1008033341 | C -> T | LOC_Os10g15250.1 | downstream_gene_variant ; 39.0bp to feature; MODIFIER | silent_mutation | Average:25.701; most accessible tissue: Callus, score: 52.905 | N | N | N | N |
| vg1008033341 | C -> T | LOC_Os10g15240.1 | downstream_gene_variant ; 636.0bp to feature; MODIFIER | silent_mutation | Average:25.701; most accessible tissue: Callus, score: 52.905 | N | N | N | N |
| vg1008033341 | C -> T | LOC_Os10g15250-LOC_Os10g15240 | intergenic_region ; MODIFIER | silent_mutation | Average:25.701; most accessible tissue: Callus, score: 52.905 | N | N | N | N |
| vg1008033341 | C -> DEL | N | N | silent_mutation | Average:25.701; most accessible tissue: Callus, score: 52.905 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1008033341 | 9.83E-07 | NA | mr1110 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008033341 | NA | 2.20E-12 | mr1118 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008033341 | NA | 4.80E-10 | mr1161 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008033341 | NA | 1.87E-12 | mr1495 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008033341 | NA | 7.87E-08 | mr1496 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008033341 | NA | 4.41E-06 | mr1936 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008033341 | NA | 1.14E-09 | mr1161_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |