| Variant ID: vg1007941662 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 7941662 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.02, others allele: 0.00, population size: 122. )
TTAGGTATGTAATAATGAATTGTGAAATAAAGTTGAGTTTGAGTTGTTTTGTTGTTAGGTATATGTATGAATCAAATTCATATACCTAGGTATATACTCA[C/T]
AATTTGAAAATTTTTAAAAATTTGAGAGAATTTGTGTGTTTTATACCTTGGAGCCCAGGCACCATGGAGTCCCATATGGGTATCATATGCACCAACGATC
GATCGTTGGTGCATATGATACCCATATGGGACTCCATGGTGCCTGGGCTCCAAGGTATAAAACACACAAATTCTCTCAAATTTTTAAAAATTTTCAAATT[G/A]
TGAGTATATACCTAGGTATATGAATTTGATTCATACATATACCTAACAACAAAACAACTCAAACTCAACTTTATTTCACAATTCATTATTACATACCTAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.90% | 19.00% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 75.30% | 24.70% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 86.40% | 13.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 77.80% | 22.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 56.10% | 43.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 78.40% | 21.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 95.40% | 4.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 77.80% | 22.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 75.90% | 24.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 11.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1007941662 | C -> T | LOC_Os10g15150.1 | upstream_gene_variant ; 2104.0bp to feature; MODIFIER | silent_mutation | Average:41.874; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| vg1007941662 | C -> T | LOC_Os10g15140-LOC_Os10g15150 | intergenic_region ; MODIFIER | silent_mutation | Average:41.874; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1007941662 | 5.89E-07 | 3.91E-12 | mr1113 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007941662 | 1.57E-08 | 4.66E-12 | mr1114 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007941662 | 1.71E-07 | NA | mr1116 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007941662 | 8.01E-09 | 2.12E-13 | mr1116 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007941662 | NA | 3.38E-06 | mr1117 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007941662 | 4.31E-07 | 1.54E-17 | mr1118 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007941662 | NA | 1.11E-08 | mr1119 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007941662 | NA | 3.65E-07 | mr1120 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007941662 | NA | 8.50E-14 | mr1183 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007941662 | NA | 1.46E-09 | mr1183 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/