\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1007933835:

Variant ID: vg1007933835 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 7933835
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


CCGATCCCTAGGGTGTGGTCAGGGTAACTTCCCTACGTCTACAGTCGATTACCCCTCTGTTCTTTGTTAACCAATCCATACCCAATATGACATCCAGGGT[C/T]
TGGGGTATCAATACCATAAGGTTGGAGGGAAACACCACATCCCTAAGACGAATAGGTATGTTTATGCAAGCATGACTCACAGTTATCTCGCCCCCAGGTG

Reverse complement sequence

CACCTGGGGGCGAGATAACTGTGAGTCATGCTTGCATAAACATACCTATTCGTCTTAGGGATGTGGTGTTTCCCTCCAACCTTATGGTATTGATACCCCA[G/A]
ACCCTGGATGTCATATTGGGTATGGATTGGTTAACAAAGAACAGAGGGGTAATCGACTGTAGACGTAGGGAAGTTACCCTGACCACACCCTAGGGATCGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.40% 8.40% 6.07% 8.13% NA
All Indica  2759 73.50% 2.60% 10.26% 13.59% NA
All Japonica  1512 97.80% 1.70% 0.20% 0.33% NA
Aus  269 2.20% 97.80% 0.00% 0.00% NA
Indica I  595 30.90% 1.80% 25.55% 41.68% NA
Indica II  465 90.80% 0.40% 4.52% 4.30% NA
Indica III  913 91.70% 2.00% 4.05% 2.30% NA
Indica Intermediate  786 74.40% 5.30% 9.29% 10.94% NA
Temperate Japonica  767 99.50% 0.00% 0.26% 0.26% NA
Tropical Japonica  504 95.00% 4.40% 0.20% 0.40% NA
Japonica Intermediate  241 97.90% 1.70% 0.00% 0.41% NA
VI/Aromatic  96 72.90% 27.10% 0.00% 0.00% NA
Intermediate  90 83.30% 11.10% 1.11% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1007933835 C -> T LOC_Os10g15130.1 upstream_gene_variant ; 115.0bp to feature; MODIFIER silent_mutation Average:27.395; most accessible tissue: Minghui63 young leaf, score: 73.49 N N N N
vg1007933835 C -> T LOC_Os10g15120.1 downstream_gene_variant ; 3652.0bp to feature; MODIFIER silent_mutation Average:27.395; most accessible tissue: Minghui63 young leaf, score: 73.49 N N N N
vg1007933835 C -> T LOC_Os10g15140.1 downstream_gene_variant ; 1002.0bp to feature; MODIFIER silent_mutation Average:27.395; most accessible tissue: Minghui63 young leaf, score: 73.49 N N N N
vg1007933835 C -> T LOC_Os10g15130-LOC_Os10g15140 intergenic_region ; MODIFIER silent_mutation Average:27.395; most accessible tissue: Minghui63 young leaf, score: 73.49 N N N N
vg1007933835 C -> DEL N N silent_mutation Average:27.395; most accessible tissue: Minghui63 young leaf, score: 73.49 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1007933835 NA 1.67E-06 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007933835 4.33E-07 NA mr1088 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007933835 NA 4.16E-26 mr1095 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007933835 NA 1.22E-30 mr1098 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007933835 NA 5.40E-28 mr1099 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007933835 NA 1.44E-06 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007933835 NA 1.84E-21 mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007933835 NA 6.05E-07 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007933835 NA 7.51E-26 mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007933835 NA 9.39E-12 mr1409 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007933835 NA 1.79E-06 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007933835 NA 1.53E-25 mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007933835 NA 6.04E-22 mr1589 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007933835 NA 2.73E-07 mr1762 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007933835 NA 3.50E-26 mr1858 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007933835 NA 3.16E-26 mr1859 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007933835 NA 2.50E-18 mr1911 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007933835 NA 2.93E-12 mr1918 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007933835 NA 3.42E-19 mr1961 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007933835 NA 8.74E-20 mr1095_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007933835 NA 4.05E-06 mr1528_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007933835 NA 9.00E-08 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007933835 NA 1.45E-14 mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007933835 NA 1.58E-06 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251