Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1007933835:

Variant ID: vg1007933835 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 7933835
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:

CCGATCCCTAGGGTGTGGTCAGGGTAACTTCCCTACGTCTACAGTCGATTACCCCTCTGTTCTTTGTTAACCAATCCATACCCAATATGACATCCAGGGT[C/T]
TGGGGTATCAATACCATAAGGTTGGAGGGAAACACCACATCCCTAAGACGAATAGGTATGTTTATGCAAGCATGACTCACAGTTATCTCGCCCCCAGGTG

Reverse complement sequence

CACCTGGGGGCGAGATAACTGTGAGTCATGCTTGCATAAACATACCTATTCGTCTTAGGGATGTGGTGTTTCCCTCCAACCTTATGGTATTGATACCCCA[G/A]
ACCCTGGATGTCATATTGGGTATGGATTGGTTAACAAAGAACAGAGGGGTAATCGACTGTAGACGTAGGGAAGTTACCCTGACCACACCCTAGGGATCGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.40%	8.40%	6.07%	8.13%	NA
All Indica	2759	73.50%	2.60%	10.26%	13.59%	NA
All Japonica	1512	97.80%	1.70%	0.20%	0.33%	NA
Aus	269	2.20%	97.80%	0.00%	0.00%	NA
Indica I	595	30.90%	1.80%	25.55%	41.68%	NA
Indica II	465	90.80%	0.40%	4.52%	4.30%	NA
Indica III	913	91.70%	2.00%	4.05%	2.30%	NA
Indica Intermediate	786	74.40%	5.30%	9.29%	10.94%	NA
Temperate Japonica	767	99.50%	0.00%	0.26%	0.26%	NA
Tropical Japonica	504	95.00%	4.40%	0.20%	0.40%	NA
Japonica Intermediate	241	97.90%	1.70%	0.00%	0.41%	NA
VI/Aromatic	96	72.90%	27.10%	0.00%	0.00%	NA
Intermediate	90	83.30%	11.10%	1.11%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1007933835	C -> T	LOC_Os10g15130.1	upstream_gene_variant ; 115.0bp to feature; MODIFIER	silent_mutation	Average:27.395; most accessible tissue: Minghui63 young leaf, score: 73.49	N	N	N	N
vg1007933835	C -> T	LOC_Os10g15120.1	downstream_gene_variant ; 3652.0bp to feature; MODIFIER	silent_mutation	Average:27.395; most accessible tissue: Minghui63 young leaf, score: 73.49	N	N	N	N
vg1007933835	C -> T	LOC_Os10g15140.1	downstream_gene_variant ; 1002.0bp to feature; MODIFIER	silent_mutation	Average:27.395; most accessible tissue: Minghui63 young leaf, score: 73.49	N	N	N	N
vg1007933835	C -> T	LOC_Os10g15130-LOC_Os10g15140	intergenic_region ; MODIFIER	silent_mutation	Average:27.395; most accessible tissue: Minghui63 young leaf, score: 73.49	N	N	N	N
vg1007933835	C -> DEL	N	N	silent_mutation	Average:27.395; most accessible tissue: Minghui63 young leaf, score: 73.49	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1007933835	NA	1.67E-06	mr1058	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007933835	4.33E-07	NA	mr1088	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007933835	NA	4.16E-26	mr1095	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007933835	NA	1.22E-30	mr1098	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007933835	NA	5.40E-28	mr1099	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007933835	NA	1.44E-06	mr1126	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007933835	NA	1.84E-21	mr1210	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007933835	NA	6.05E-07	mr1262	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007933835	NA	7.51E-26	mr1305	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007933835	NA	9.39E-12	mr1409	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007933835	NA	1.79E-06	mr1574	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007933835	NA	1.53E-25	mr1586	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007933835	NA	6.04E-22	mr1589	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007933835	NA	2.73E-07	mr1762	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007933835	NA	3.50E-26	mr1858	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007933835	NA	3.16E-26	mr1859	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007933835	NA	2.50E-18	mr1911	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007933835	NA	2.93E-12	mr1918	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007933835	NA	3.42E-19	mr1961	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007933835	NA	8.74E-20	mr1095_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007933835	NA	4.05E-06	mr1528_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007933835	NA	9.00E-08	mr1642_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007933835	NA	1.45E-14	mr1794_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007933835	NA	1.58E-06	mr1815_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251