Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1007924793:

Variant ID: vg1007924793 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 7924793
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 309. )

Flanking Sequence (100 bp) in Reference Genome:

AGTTTACTATAATTTCACCACGATGTTACTGCCATAGGTGCAGTAACGTTCTATATGTCCTACAGTAACAAAGTGTTTTACTGCAGCTCTTGGATAGTGT[T/A]
ACTGCATAAACATGCGGTAATGTGTAACTGTCAGGTGGTAACGTGTATCTGTCGTGCAGTAACACTTTTACTTTTGTGCAGTAACAAGTATATGGTTAGC

Reverse complement sequence

GCTAACCATATACTTGTTACTGCACAAAAGTAAAAGTGTTACTGCACGACAGATACACGTTACCACCTGACAGTTACACATTACCGCATGTTTATGCAGT[A/T]
ACACTATCCAAGAGCTGCAGTAAAACACTTTGTTACTGTAGGACATATAGAACGTTACTGCACCTATGGCAGTAACATCGTGGTGAAATTATAGTAAACT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.10%	5.30%	0.59%	0.00%	NA
All Indica	2759	100.00%	0.00%	0.00%	0.00%	NA
All Japonica	1512	82.20%	16.00%	1.79%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	100.00%	0.00%	0.00%	0.00%	NA
Temperate Japonica	767	67.40%	29.10%	3.52%	0.00%	NA
Tropical Japonica	504	98.20%	1.80%	0.00%	0.00%	NA
Japonica Intermediate	241	95.90%	4.10%	0.00%	0.00%	NA
VI/Aromatic	96	94.80%	5.20%	0.00%	0.00%	NA
Intermediate	90	96.70%	2.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1007924793	T -> A	LOC_Os10g15120.1	upstream_gene_variant ; 4995.0bp to feature; MODIFIER	silent_mutation	Average:44.714; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg1007924793	T -> A	LOC_Os10g15100-LOC_Os10g15120	intergenic_region ; MODIFIER	silent_mutation	Average:44.714; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1007924793	7.86E-08	NA	mr1210	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007924793	NA	2.80E-10	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007924793	1.94E-06	NA	mr1300	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007924793	NA	4.43E-06	mr1300	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007924793	2.41E-09	NA	mr1305	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007924793	7.82E-07	4.25E-11	mr1305	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007924793	NA	4.00E-06	mr1515	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007924793	1.14E-06	NA	mr1585	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007924793	NA	7.04E-12	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007924793	2.52E-08	NA	mr1586	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007924793	NA	1.38E-09	mr1586	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007924793	NA	5.85E-09	mr1624	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007924793	NA	2.42E-07	mr1765	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007924793	NA	9.75E-06	mr1788	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007924793	2.75E-06	2.75E-06	mr1166_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007924793	7.44E-09	NA	mr1305_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007924793	1.47E-07	1.53E-11	mr1305_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007924793	5.32E-07	NA	mr1310_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007924793	NA	1.27E-07	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007924793	NA	1.21E-06	mr1409_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007924793	1.76E-06	4.81E-08	mr1559_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007924793	5.93E-06	3.02E-06	mr1559_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007924793	2.02E-13	2.83E-14	mr1585_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007924793	1.05E-09	1.06E-17	mr1585_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007924793	NA	2.51E-06	mr1693_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007924793	NA	6.75E-06	mr1703_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007924793	NA	3.93E-07	mr1765_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007924793	NA	3.90E-06	mr1793_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007924793	NA	5.58E-06	mr1959_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251