\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1007919865:

Variant ID: vg1007919865 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 7919865
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATGGGGGTTTTAATGCACATTCTGCTTGGAATCCTATTCAGGAATTTCTGGGCGTGACAATGACCTCTGTTCAGAAACACTGTGTCTTACGTGCAGTAA[C/T]
AGCGTTAAAATATAGTTGAAATATAGTCGTGACGGATCTACTTTTGATAAGCTCTTTTTTTCTAGCATCATGGTGCAAACGGTTTTAAAAAACCTTACAT

Reverse complement sequence

ATGTAAGGTTTTTTAAAACCGTTTGCACCATGATGCTAGAAAAAAAGAGCTTATCAAAAGTAGATCCGTCACGACTATATTTCAACTATATTTTAACGCT[G/A]
TTACTGCACGTAAGACACAGTGTTTCTGAACAGAGGTCATTGTCACGCCCAGAAATTCCTGAATAGGATTCCAAGCAGAATGTGCATTAAAACCCCCATC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.70% 5.60% 1.16% 5.59% NA
All Indica  2759 99.20% 0.00% 0.04% 0.76% NA
All Japonica  1512 67.10% 16.60% 3.31% 12.96% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.00% 0.00% 0.22% NA
Indica III  913 97.90% 0.10% 0.11% 1.86% NA
Indica Intermediate  786 99.60% 0.00% 0.00% 0.38% NA
Temperate Japonica  767 62.60% 29.60% 3.13% 4.69% NA
Tropical Japonica  504 64.70% 2.60% 4.56% 28.17% NA
Japonica Intermediate  241 86.70% 4.60% 1.24% 7.47% NA
VI/Aromatic  96 53.10% 8.30% 1.04% 37.50% NA
Intermediate  90 81.10% 3.30% 3.33% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1007919865 C -> T LOC_Os10g15100-LOC_Os10g15120 intergenic_region ; MODIFIER silent_mutation Average:23.514; most accessible tissue: Minghui63 flag leaf, score: 35.832 N N N N
vg1007919865 C -> DEL N N silent_mutation Average:23.514; most accessible tissue: Minghui63 flag leaf, score: 35.832 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1007919865 7.31E-06 NA mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007919865 NA 1.01E-08 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007919865 1.15E-06 NA mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007919865 4.58E-07 NA mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007919865 NA 1.23E-09 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007919865 3.35E-06 NA mr1515 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007919865 NA 2.34E-08 mr1515 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007919865 8.11E-06 NA mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007919865 NA 4.14E-10 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007919865 5.41E-06 NA mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007919865 NA 4.38E-08 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007919865 NA 1.90E-08 mr1624 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007919865 NA 2.59E-07 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007919865 NA 7.50E-06 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007919865 NA 4.75E-06 mr1922 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007919865 1.83E-06 1.83E-06 mr1166_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007919865 7.79E-06 NA mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007919865 NA 1.48E-09 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007919865 1.12E-06 NA mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007919865 NA 3.43E-07 mr1409_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007919865 NA 7.59E-08 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007919865 NA 4.63E-07 mr1559_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007919865 1.71E-08 1.38E-09 mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007919865 2.16E-06 2.72E-13 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007919865 NA 7.64E-06 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007919865 NA 3.99E-06 mr1793_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251