\
| Variant ID: vg1007919865 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 7919865 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GATGGGGGTTTTAATGCACATTCTGCTTGGAATCCTATTCAGGAATTTCTGGGCGTGACAATGACCTCTGTTCAGAAACACTGTGTCTTACGTGCAGTAA[C/T]
AGCGTTAAAATATAGTTGAAATATAGTCGTGACGGATCTACTTTTGATAAGCTCTTTTTTTCTAGCATCATGGTGCAAACGGTTTTAAAAAACCTTACAT
ATGTAAGGTTTTTTAAAACCGTTTGCACCATGATGCTAGAAAAAAAGAGCTTATCAAAAGTAGATCCGTCACGACTATATTTCAACTATATTTTAACGCT[G/A]
TTACTGCACGTAAGACACAGTGTTTCTGAACAGAGGTCATTGTCACGCCCAGAAATTCCTGAATAGGATTCCAAGCAGAATGTGCATTAAAACCCCCATC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.70% | 5.60% | 1.16% | 5.59% | NA |
| All Indica | 2759 | 99.20% | 0.00% | 0.04% | 0.76% | NA |
| All Japonica | 1512 | 67.10% | 16.60% | 3.31% | 12.96% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.00% | 0.00% | 0.22% | NA |
| Indica III | 913 | 97.90% | 0.10% | 0.11% | 1.86% | NA |
| Indica Intermediate | 786 | 99.60% | 0.00% | 0.00% | 0.38% | NA |
| Temperate Japonica | 767 | 62.60% | 29.60% | 3.13% | 4.69% | NA |
| Tropical Japonica | 504 | 64.70% | 2.60% | 4.56% | 28.17% | NA |
| Japonica Intermediate | 241 | 86.70% | 4.60% | 1.24% | 7.47% | NA |
| VI/Aromatic | 96 | 53.10% | 8.30% | 1.04% | 37.50% | NA |
| Intermediate | 90 | 81.10% | 3.30% | 3.33% | 12.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1007919865 | C -> T | LOC_Os10g15100-LOC_Os10g15120 | intergenic_region ; MODIFIER | silent_mutation | Average:23.514; most accessible tissue: Minghui63 flag leaf, score: 35.832 | N | N | N | N |
| vg1007919865 | C -> DEL | N | N | silent_mutation | Average:23.514; most accessible tissue: Minghui63 flag leaf, score: 35.832 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1007919865 | 7.31E-06 | NA | mr1210 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007919865 | NA | 1.01E-08 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007919865 | 1.15E-06 | NA | mr1300 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007919865 | 4.58E-07 | NA | mr1305 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007919865 | NA | 1.23E-09 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007919865 | 3.35E-06 | NA | mr1515 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007919865 | NA | 2.34E-08 | mr1515 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007919865 | 8.11E-06 | NA | mr1585 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007919865 | NA | 4.14E-10 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007919865 | 5.41E-06 | NA | mr1586 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007919865 | NA | 4.38E-08 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007919865 | NA | 1.90E-08 | mr1624 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007919865 | NA | 2.59E-07 | mr1765 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007919865 | NA | 7.50E-06 | mr1788 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007919865 | NA | 4.75E-06 | mr1922 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007919865 | 1.83E-06 | 1.83E-06 | mr1166_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007919865 | 7.79E-06 | NA | mr1305_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007919865 | NA | 1.48E-09 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007919865 | 1.12E-06 | NA | mr1310_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007919865 | NA | 3.43E-07 | mr1409_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007919865 | NA | 7.59E-08 | mr1559_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007919865 | NA | 4.63E-07 | mr1559_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007919865 | 1.71E-08 | 1.38E-09 | mr1585_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007919865 | 2.16E-06 | 2.72E-13 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007919865 | NA | 7.64E-06 | mr1765_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007919865 | NA | 3.99E-06 | mr1793_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |