\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1007916498:

Variant ID: vg1007916498 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 7916498
Reference Allele: TAlternative Allele: G,A
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCAGCATTGGGGTGCTGTTCAGTGTTGATTAATATGGATGATTAATTACTCTACTGTTTTACTATTCTTAAATCTTTGCTAAATGATGCTTTTGCAAAT[T/G,A]
AGCCTATATTATGCCATCCTTTGGTATCCTTATGCACTTGGATATTTGTTATGTAGCTTGTTGAGTATGTCATATGCTCATTCTTGCAATAATCATCAAA

Reverse complement sequence

TTTGATGATTATTGCAAGAATGAGCATATGACATACTCAACAAGCTACATAACAAATATCCAAGTGCATAAGGATACCAAAGGATGGCATAATATAGGCT[A/C,T]
ATTTGCAAAAGCATCATTTAGCAAAGATTTAAGAATAGTAAAACAGTAGAGTAATTAATCATCCATATTAATCAACACTGAACAGCACCCCAATGCTGCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.60% 14.60% 2.67% 4.57% A: 0.53%
All Indica  2759 93.50% 2.80% 2.61% 1.05% A: 0.04%
All Japonica  1512 46.50% 39.50% 1.26% 11.44% A: 1.32%
Aus  269 98.90% 0.40% 0.37% 0.00% A: 0.37%
Indica I  595 85.40% 5.40% 6.89% 2.35% NA
Indica II  465 95.50% 3.20% 1.08% 0.22% NA
Indica III  913 96.80% 0.80% 1.53% 0.77% A: 0.11%
Indica Intermediate  786 94.80% 2.80% 1.53% 0.89% NA
Temperate Japonica  767 40.30% 55.40% 0.26% 3.78% A: 0.26%
Tropical Japonica  504 59.70% 8.10% 3.17% 25.79% A: 3.17%
Japonica Intermediate  241 38.60% 54.40% 0.41% 5.81% A: 0.83%
VI/Aromatic  96 64.60% 0.00% 28.12% 6.25% A: 1.04%
Intermediate  90 61.10% 20.00% 7.78% 8.89% A: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1007916498 T -> G LOC_Os10g15100.1 downstream_gene_variant ; 3247.0bp to feature; MODIFIER silent_mutation Average:19.217; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg1007916498 T -> G LOC_Os10g15100-LOC_Os10g15120 intergenic_region ; MODIFIER silent_mutation Average:19.217; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg1007916498 T -> A LOC_Os10g15100.1 downstream_gene_variant ; 3247.0bp to feature; MODIFIER silent_mutation Average:19.217; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg1007916498 T -> A LOC_Os10g15100-LOC_Os10g15120 intergenic_region ; MODIFIER silent_mutation Average:19.217; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg1007916498 T -> DEL N N silent_mutation Average:19.217; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1007916498 6.03E-07 6.04E-07 mr1061 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007916498 NA 6.07E-17 mr1768 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007916498 NA 8.64E-06 mr1768 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007916498 NA 2.64E-08 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007916498 5.24E-07 1.02E-29 mr1768_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007916498 NA 9.48E-09 mr1768_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251