Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1007916498:

Variant ID: vg1007916498 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 7916498
Reference Allele: T	Alternative Allele: G,A
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGCAGCATTGGGGTGCTGTTCAGTGTTGATTAATATGGATGATTAATTACTCTACTGTTTTACTATTCTTAAATCTTTGCTAAATGATGCTTTTGCAAAT[T/G,A]
AGCCTATATTATGCCATCCTTTGGTATCCTTATGCACTTGGATATTTGTTATGTAGCTTGTTGAGTATGTCATATGCTCATTCTTGCAATAATCATCAAA

Reverse complement sequence

TTTGATGATTATTGCAAGAATGAGCATATGACATACTCAACAAGCTACATAACAAATATCCAAGTGCATAAGGATACCAAAGGATGGCATAATATAGGCT[A/C,T]
ATTTGCAAAAGCATCATTTAGCAAAGATTTAAGAATAGTAAAACAGTAGAGTAATTAATCATCCATATTAATCAACACTGAACAGCACCCCAATGCTGCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.60%	14.60%	2.67%	4.57%	A: 0.53%
All Indica	2759	93.50%	2.80%	2.61%	1.05%	A: 0.04%
All Japonica	1512	46.50%	39.50%	1.26%	11.44%	A: 1.32%
Aus	269	98.90%	0.40%	0.37%	0.00%	A: 0.37%
Indica I	595	85.40%	5.40%	6.89%	2.35%	NA
Indica II	465	95.50%	3.20%	1.08%	0.22%	NA
Indica III	913	96.80%	0.80%	1.53%	0.77%	A: 0.11%
Indica Intermediate	786	94.80%	2.80%	1.53%	0.89%	NA
Temperate Japonica	767	40.30%	55.40%	0.26%	3.78%	A: 0.26%
Tropical Japonica	504	59.70%	8.10%	3.17%	25.79%	A: 3.17%
Japonica Intermediate	241	38.60%	54.40%	0.41%	5.81%	A: 0.83%
VI/Aromatic	96	64.60%	0.00%	28.12%	6.25%	A: 1.04%
Intermediate	90	61.10%	20.00%	7.78%	8.89%	A: 2.22%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1007916498	T -> G	LOC_Os10g15100.1	downstream_gene_variant ; 3247.0bp to feature; MODIFIER	silent_mutation	Average:19.217; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg1007916498	T -> G	LOC_Os10g15100-LOC_Os10g15120	intergenic_region ; MODIFIER	silent_mutation	Average:19.217; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg1007916498	T -> A	LOC_Os10g15100.1	downstream_gene_variant ; 3247.0bp to feature; MODIFIER	silent_mutation	Average:19.217; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg1007916498	T -> A	LOC_Os10g15100-LOC_Os10g15120	intergenic_region ; MODIFIER	silent_mutation	Average:19.217; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg1007916498	T -> DEL	N	N	silent_mutation	Average:19.217; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1007916498	6.03E-07	6.04E-07	mr1061	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007916498	NA	6.07E-17	mr1768	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007916498	NA	8.64E-06	mr1768	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007916498	NA	2.64E-08	mr1709_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007916498	5.24E-07	1.02E-29	mr1768_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007916498	NA	9.48E-09	mr1768_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251