\
| Variant ID: vg1007916498 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 7916498 |
| Reference Allele: T | Alternative Allele: G,A |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TGCAGCATTGGGGTGCTGTTCAGTGTTGATTAATATGGATGATTAATTACTCTACTGTTTTACTATTCTTAAATCTTTGCTAAATGATGCTTTTGCAAAT[T/G,A]
AGCCTATATTATGCCATCCTTTGGTATCCTTATGCACTTGGATATTTGTTATGTAGCTTGTTGAGTATGTCATATGCTCATTCTTGCAATAATCATCAAA
TTTGATGATTATTGCAAGAATGAGCATATGACATACTCAACAAGCTACATAACAAATATCCAAGTGCATAAGGATACCAAAGGATGGCATAATATAGGCT[A/C,T]
ATTTGCAAAAGCATCATTTAGCAAAGATTTAAGAATAGTAAAACAGTAGAGTAATTAATCATCCATATTAATCAACACTGAACAGCACCCCAATGCTGCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 77.60% | 14.60% | 2.67% | 4.57% | A: 0.53% |
| All Indica | 2759 | 93.50% | 2.80% | 2.61% | 1.05% | A: 0.04% |
| All Japonica | 1512 | 46.50% | 39.50% | 1.26% | 11.44% | A: 1.32% |
| Aus | 269 | 98.90% | 0.40% | 0.37% | 0.00% | A: 0.37% |
| Indica I | 595 | 85.40% | 5.40% | 6.89% | 2.35% | NA |
| Indica II | 465 | 95.50% | 3.20% | 1.08% | 0.22% | NA |
| Indica III | 913 | 96.80% | 0.80% | 1.53% | 0.77% | A: 0.11% |
| Indica Intermediate | 786 | 94.80% | 2.80% | 1.53% | 0.89% | NA |
| Temperate Japonica | 767 | 40.30% | 55.40% | 0.26% | 3.78% | A: 0.26% |
| Tropical Japonica | 504 | 59.70% | 8.10% | 3.17% | 25.79% | A: 3.17% |
| Japonica Intermediate | 241 | 38.60% | 54.40% | 0.41% | 5.81% | A: 0.83% |
| VI/Aromatic | 96 | 64.60% | 0.00% | 28.12% | 6.25% | A: 1.04% |
| Intermediate | 90 | 61.10% | 20.00% | 7.78% | 8.89% | A: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1007916498 | T -> G | LOC_Os10g15100.1 | downstream_gene_variant ; 3247.0bp to feature; MODIFIER | silent_mutation | Average:19.217; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg1007916498 | T -> G | LOC_Os10g15100-LOC_Os10g15120 | intergenic_region ; MODIFIER | silent_mutation | Average:19.217; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg1007916498 | T -> A | LOC_Os10g15100.1 | downstream_gene_variant ; 3247.0bp to feature; MODIFIER | silent_mutation | Average:19.217; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg1007916498 | T -> A | LOC_Os10g15100-LOC_Os10g15120 | intergenic_region ; MODIFIER | silent_mutation | Average:19.217; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg1007916498 | T -> DEL | N | N | silent_mutation | Average:19.217; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1007916498 | 6.03E-07 | 6.04E-07 | mr1061 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007916498 | NA | 6.07E-17 | mr1768 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007916498 | NA | 8.64E-06 | mr1768 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007916498 | NA | 2.64E-08 | mr1709_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007916498 | 5.24E-07 | 1.02E-29 | mr1768_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007916498 | NA | 9.48E-09 | mr1768_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |