| Variant ID: vg1007906158 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 7906158 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CGAGGATTAGGCTTCATCCGAGCCGTCGAGGATGCCTGTGGAGTGGTGTTCCCATTGCAGTCCAAGTCAAGGCTTAGCTCCAGTTATCTTTTAATTTTCC[G/A]
CTGCATTTGTGTAATGTCACGCCCAGAAATTCACTAGTAATTTCCGAACTTATTTGTGCATTAAATCCTCGTCCAGGAATCAGCCGAGGTACACAAACTG
CAGTTTGTGTACCTCGGCTGATTCCTGGACGAGGATTTAATGCACAAATAAGTTCGGAAATTACTAGTGAATTTCTGGGCGTGACATTACACAAATGCAG[C/T]
GGAAAATTAAAAGATAACTGGAGCTAAGCCTTGACTTGGACTGCAATGGGAACACCACTCCACAGGCATCCTCGACGGCTCGGATGAAGCCTAATCCTCG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 28.60% | 1.70% | 3.83% | 65.95% | NA |
| All Indica | 2759 | 8.00% | 0.00% | 4.86% | 87.10% | NA |
| All Japonica | 1512 | 68.10% | 4.90% | 2.45% | 24.60% | NA |
| Aus | 269 | 1.50% | 0.00% | 0.74% | 97.77% | NA |
| Indica I | 595 | 7.60% | 0.00% | 2.69% | 89.75% | NA |
| Indica II | 465 | 8.40% | 0.20% | 4.95% | 86.45% | NA |
| Indica III | 913 | 9.10% | 0.00% | 6.79% | 84.12% | NA |
| Indica Intermediate | 786 | 6.90% | 0.00% | 4.20% | 88.93% | NA |
| Temperate Japonica | 767 | 88.80% | 4.40% | 0.91% | 5.87% | NA |
| Tropical Japonica | 504 | 39.30% | 6.50% | 4.56% | 49.60% | NA |
| Japonica Intermediate | 241 | 62.20% | 2.90% | 2.90% | 31.95% | NA |
| VI/Aromatic | 96 | 56.20% | 0.00% | 5.21% | 38.54% | NA |
| Intermediate | 90 | 46.70% | 3.30% | 3.33% | 46.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1007906158 | G -> A | LOC_Os10g15079-LOC_Os10g15100 | intergenic_region ; MODIFIER | silent_mutation | Average:13.443; most accessible tissue: Zhenshan97 root, score: 22.162 | N | N | N | N |
| vg1007906158 | G -> DEL | N | N | silent_mutation | Average:13.443; most accessible tissue: Zhenshan97 root, score: 22.162 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1007906158 | NA | 3.50E-06 | mr1232_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007906158 | 1.24E-06 | 8.13E-09 | mr1398_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007906158 | NA | 6.86E-06 | mr1415_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007906158 | 3.88E-06 | 3.88E-06 | mr1424_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007906158 | NA | 6.25E-06 | mr1510_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007906158 | NA | 5.81E-06 | mr1557_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007906158 | NA | 2.34E-07 | mr1558_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007906158 | 2.09E-06 | 2.09E-06 | mr1562_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007906158 | NA | 1.15E-08 | mr1676_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007906158 | NA | 7.79E-06 | mr1944_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/