\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1007863061:

Variant ID: vg1007863061 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 7863061
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:


GTTATGTTACTGCACGATAATCATAGTTTTACTATGTCTGTTTTACGAGATGAAGGTCGAATAGGTGGGCTATAGGTAAAGTCTGTAGGTGGTTTTGAGT[A/G]
AGGTCTGATTGATGTAGGAGTGTTTTCAACAATTTTATACATTTGGTAAAACTATGTTACTGCATATATATACCCATGTTACTGCAAATTACATATTCTG

Reverse complement sequence

CAGAATATGTAATTTGCAGTAACATGGGTATATATATGCAGTAACATAGTTTTACCAAATGTATAAAATTGTTGAAAACACTCCTACATCAATCAGACCT[T/C]
ACTCAAAACCACCTACAGACTTTACCTATAGCCCACCTATTCGACCTTCATCTCGTAAAACAGACATAGTAAAACTATGATTATCGTGCAGTAACATAAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 29.70% 0.50% 2.39% 67.41% NA
All Indica  2759 5.80% 0.70% 4.06% 89.38% NA
All Japonica  1512 76.30% 0.00% 0.00% 23.74% NA
Aus  269 1.10% 0.70% 0.37% 97.77% NA
Indica I  595 10.80% 0.50% 3.53% 85.21% NA
Indica II  465 3.70% 0.60% 2.58% 93.12% NA
Indica III  913 3.60% 1.10% 5.70% 89.59% NA
Indica Intermediate  786 6.00% 0.50% 3.44% 90.08% NA
Temperate Japonica  767 94.70% 0.00% 0.00% 5.35% NA
Tropical Japonica  504 51.40% 0.00% 0.00% 48.61% NA
Japonica Intermediate  241 69.70% 0.00% 0.00% 30.29% NA
VI/Aromatic  96 47.90% 0.00% 0.00% 52.08% NA
Intermediate  90 46.70% 0.00% 0.00% 53.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1007863061 A -> G LOC_Os10g15010.1 upstream_gene_variant ; 2771.0bp to feature; MODIFIER silent_mutation Average:8.473; most accessible tissue: Callus, score: 39.345 N N N N
vg1007863061 A -> G LOC_Os10g15020.1 upstream_gene_variant ; 3552.0bp to feature; MODIFIER silent_mutation Average:8.473; most accessible tissue: Callus, score: 39.345 N N N N
vg1007863061 A -> G LOC_Os10g15010-LOC_Os10g15020 intergenic_region ; MODIFIER silent_mutation Average:8.473; most accessible tissue: Callus, score: 39.345 N N N N
vg1007863061 A -> DEL N N silent_mutation Average:8.473; most accessible tissue: Callus, score: 39.345 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1007863061 NA 2.81E-11 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007863061 NA 7.93E-13 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007863061 NA 9.19E-13 mr1335 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007863061 NA 7.54E-06 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007863061 NA 1.02E-06 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007863061 NA 1.16E-12 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007863061 NA 2.69E-07 mr1110_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007863061 NA 6.06E-06 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007863061 NA 8.32E-10 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007863061 NA 7.36E-09 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007863061 NA 1.08E-11 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007863061 2.00E-06 NA mr1641_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007863061 7.96E-06 NA mr1653_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007863061 NA 4.76E-09 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007863061 NA 7.41E-13 mr1713_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007863061 NA 9.85E-08 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007863061 NA 1.37E-07 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007863061 NA 4.57E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007863061 NA 5.72E-08 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007863061 NA 4.74E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007863061 NA 7.28E-07 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251