| Variant ID: vg1007792154 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 7792154 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TGCAGGATAAATGCAAGGGAGTACAAGGGGGTTATAATATAAAGGGTTAGGGTTTGCAGTAAACAACATTAAAAGACACTTAGTTGCTAAAAGCTATTTT[G/A]
TAAACACGATTCTAGAGCTATACAATATTATTAATCAAGGCCGTGAACCCACACGAACCTACCCTAACCTAAGGCCTACGATGATTCAGACCGAACTGGC
GCCAGTTCGGTCTGAATCATCGTAGGCCTTAGGTTAGGGTAGGTTCGTGTGGGTTCACGGCCTTGATTAATAATATTGTATAGCTCTAGAATCGTGTTTA[C/T]
AAAATAGCTTTTAGCAACTAAGTGTCTTTTAATGTTGTTTACTGCAAACCCTAACCCTTTATATTATAACCCCCTTGTACTCCCTTGCATTTATCCTGCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.60% | 27.30% | 1.76% | 5.27% | NA |
| All Indica | 2759 | 64.40% | 34.70% | 0.83% | 0.07% | NA |
| All Japonica | 1512 | 63.20% | 17.30% | 3.84% | 15.61% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 90.80% | 9.10% | 0.17% | 0.00% | NA |
| Indica II | 465 | 42.20% | 56.80% | 0.86% | 0.22% | NA |
| Indica III | 913 | 61.90% | 36.80% | 1.20% | 0.11% | NA |
| Indica Intermediate | 786 | 60.60% | 38.50% | 0.89% | 0.00% | NA |
| Temperate Japonica | 767 | 59.30% | 6.30% | 6.52% | 27.90% | NA |
| Tropical Japonica | 504 | 58.90% | 37.70% | 1.19% | 2.18% | NA |
| Japonica Intermediate | 241 | 84.60% | 10.00% | 0.83% | 4.56% | NA |
| VI/Aromatic | 96 | 51.00% | 42.70% | 0.00% | 6.25% | NA |
| Intermediate | 90 | 58.90% | 33.30% | 2.22% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1007792154 | G -> A | LOC_Os10g14889.1 | intron_variant ; MODIFIER | silent_mutation | Average:25.016; most accessible tissue: Minghui63 young leaf, score: 38.036 | N | N | N | N |
| vg1007792154 | G -> DEL | N | N | silent_mutation | Average:25.016; most accessible tissue: Minghui63 young leaf, score: 38.036 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1007792154 | 4.22E-06 | NA | mr1027 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007792154 | NA | 6.67E-12 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007792154 | NA | 1.12E-08 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007792154 | 9.07E-06 | NA | mr1027_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007792154 | NA | 5.49E-07 | mr1027_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007792154 | NA | 7.38E-06 | mr1522_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007792154 | NA | 6.91E-10 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007792154 | NA | 3.86E-08 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |