Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1007771968:

Variant ID: vg1007771968 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 7771968
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAAACACAAGCCGAAGCCGACATGGAAGCCATGCGACAGAACATGACATGGCTCCAAGACATGCTTCGCCAAATGCAAAAACAACAACAAGCATACGAGG[C/T]
GGCAAGGCGGACCAAGGTCACGTCGGCTCCAATCCTTCAGTTTTCGGCAGGTTATGTCCCACCTCAAGTCCATCCGCAAGTGACGACCTAGCCCTTTCCG

Reverse complement sequence

CGGAAAGGGCTAGGTCGTCACTTGCGGATGGACTTGAGGTGGGACATAACCTGCCGAAAACTGAAGGATTGGAGCCGACGTGACCTTGGTCCGCCTTGCC[G/A]
CCTCGTATGCTTGTTGTTGTTTTTGCATTTGGCGAAGCATGTCTTGGAGCCATGTCATGTTCTGTCGCATGGCTTCCATGTCGGCTTCGGCTTGTGTTTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.00%	4.50%	6.86%	5.61%	NA
All Indica	2759	87.30%	4.50%	6.27%	1.96%	NA
All Japonica	1512	84.40%	5.70%	7.54%	2.38%	NA
Aus	269	30.10%	0.00%	12.27%	57.62%	NA
Indica I	595	97.80%	0.30%	0.67%	1.18%	NA
Indica II	465	91.00%	3.90%	4.73%	0.43%	NA
Indica III	913	78.00%	8.80%	10.30%	2.96%	NA
Indica Intermediate	786	87.90%	3.10%	6.74%	2.29%	NA
Temperate Japonica	767	95.00%	2.50%	2.22%	0.26%	NA
Tropical Japonica	504	73.20%	7.90%	13.10%	5.75%	NA
Japonica Intermediate	241	73.90%	11.20%	12.86%	2.07%	NA
VI/Aromatic	96	84.40%	0.00%	1.04%	14.58%	NA
Intermediate	90	86.70%	3.30%	3.33%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1007771968	C -> T	LOC_Os10g14840.1	missense_variant ; p.Ala130Val; MODERATE	nonsynonymous_codon ; A130V	Average:42.325; most accessible tissue: Minghui63 panicle, score: 66.554	unknown	unknown	TOLERATED	0.12
vg1007771968	C -> DEL	LOC_Os10g14840.1	N	frameshift_variant	Average:42.325; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1007771968	1.95E-06	5.37E-10	mr1113	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007771968	NA	8.79E-09	mr1114	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007771968	NA	1.01E-08	mr1116	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007771968	NA	1.51E-09	mr1118	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007771968	NA	1.11E-07	mr1119	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007771968	NA	5.07E-07	mr1183	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007771968	NA	3.91E-07	mr1247	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007771968	NA	2.31E-12	mr1495	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007771968	NA	1.01E-06	mr1495	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007771968	NA	4.18E-07	mr1503	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007771968	5.00E-07	2.66E-11	mr1794	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007771968	2.72E-06	4.06E-09	mr1794	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007771968	NA	3.17E-06	mr1842	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007771968	NA	5.94E-07	mr1917	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007771968	6.75E-07	4.80E-12	mr1113_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007771968	NA	5.98E-12	mr1114_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007771968	NA	1.82E-09	mr1117_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007771968	NA	2.78E-06	mr1118_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007771968	NA	2.28E-08	mr1119_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007771968	NA	1.37E-09	mr1120_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007771968	NA	1.54E-09	mr1247_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007771968	1.92E-09	NA	mr1258_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007771968	2.91E-10	5.01E-12	mr1258_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007771968	NA	9.24E-08	mr1441_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007771968	NA	3.14E-12	mr1495_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007771968	NA	2.21E-08	mr1495_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007771968	7.46E-06	NA	mr1794_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251