Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1007756402:

Variant ID: vg1007756402 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 7756402
Reference Allele: CAlternative Allele: T,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


ATGGAGGAGGTCGGTCGACAGCTCCCGGCGACGATGCAGGTGGAGCGGCCGGCGGCTCCCATCGATTCGGCGGCTGCCACTAATGGAGAAACCATTTTTG[C/T,A]
CCGATCGACAAAAAGCACAATAGTCTCGGATACAATAAAAACCGAGACTAAAAATGGTTTTTAGTCCCAGTTTATAAGTAGAATGGGACTACGTGATCTT

Reverse complement sequence

AAGATCACGTAGTCCCATTCTACTTATAAACTGGGACTAAAAACCATTTTTAGTCTCGGTTTTTATTGTATCCGAGACTATTGTGCTTTTTGTCGATCGG[G/A,T]
CAAAAATGGTTTCTCCATTAGTGGCAGCCGCCGAATCGATGGGAGCCGCCGGCCGCTCCACCTGCATCGTCGCCGGGAGCTGTCGACCGACCTCCTCCAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.60% 19.30% 0.08% 0.00% A: 0.02%
All Indica  2759 75.10% 24.90% 0.04% 0.00% NA
All Japonica  1512 85.80% 14.00% 0.20% 0.00% A: 0.07%
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 98.20% 1.80% 0.00% 0.00% NA
Indica II  465 77.60% 22.40% 0.00% 0.00% NA
Indica III  913 55.90% 44.10% 0.00% 0.00% NA
Indica Intermediate  786 78.50% 21.40% 0.13% 0.00% NA
Temperate Japonica  767 95.00% 4.70% 0.13% 0.00% A: 0.13%
Tropical Japonica  504 77.20% 22.80% 0.00% 0.00% NA
Japonica Intermediate  241 74.30% 24.90% 0.83% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1007756402 C -> T LOC_Os10g14795.1 upstream_gene_variant ; 2457.0bp to feature; MODIFIER silent_mutation Average:52.193; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N
vg1007756402 C -> T LOC_Os10g14800.1 upstream_gene_variant ; 1016.0bp to feature; MODIFIER silent_mutation Average:52.193; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N
vg1007756402 C -> T LOC_Os10g14814.1 downstream_gene_variant ; 4722.0bp to feature; MODIFIER silent_mutation Average:52.193; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N
vg1007756402 C -> T LOC_Os10g14795-LOC_Os10g14800 intergenic_region ; MODIFIER silent_mutation Average:52.193; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N
vg1007756402 C -> A LOC_Os10g14795.1 upstream_gene_variant ; 2457.0bp to feature; MODIFIER silent_mutation Average:52.193; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N
vg1007756402 C -> A LOC_Os10g14800.1 upstream_gene_variant ; 1016.0bp to feature; MODIFIER silent_mutation Average:52.193; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N
vg1007756402 C -> A LOC_Os10g14814.1 downstream_gene_variant ; 4722.0bp to feature; MODIFIER silent_mutation Average:52.193; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N
vg1007756402 C -> A LOC_Os10g14795-LOC_Os10g14800 intergenic_region ; MODIFIER silent_mutation Average:52.193; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1007756402 NA 1.06E-07 Grain_thickness Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1007756402 NA 3.31E-10 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007756402 2.46E-08 6.28E-13 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007756402 7.53E-08 4.73E-12 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007756402 7.83E-07 NA mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007756402 7.93E-08 1.45E-12 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007756402 NA 1.57E-06 mr1117 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007756402 4.20E-06 7.36E-15 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007756402 1.31E-09 1.25E-19 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007756402 NA 2.56E-09 mr1119 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007756402 NA 1.90E-07 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007756402 NA 5.05E-10 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007756402 6.88E-06 2.36E-15 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007756402 NA 1.41E-10 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007756402 1.93E-07 4.05E-11 mr1247 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007756402 7.06E-08 NA mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007756402 2.87E-09 2.26E-23 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007756402 NA 1.01E-06 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007756402 NA 5.13E-07 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007756402 2.82E-06 2.51E-15 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007756402 NA 5.15E-10 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007756402 2.10E-07 1.96E-16 mr1794 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007756402 1.24E-06 6.50E-13 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007756402 NA 1.58E-06 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007756402 NA 1.08E-07 mr1917 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007756402 NA 5.52E-07 mr1936 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007756402 4.15E-06 NA mr1110_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007756402 3.84E-09 5.50E-16 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007756402 1.28E-09 6.47E-17 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007756402 4.15E-08 4.93E-13 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007756402 4.25E-07 1.61E-15 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007756402 1.89E-09 2.34E-20 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007756402 NA 2.78E-06 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007756402 1.49E-07 3.37E-12 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007756402 1.99E-08 2.99E-15 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007756402 NA 8.08E-06 mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007756402 NA 3.80E-07 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007756402 NA 1.26E-09 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007756402 9.73E-07 NA mr1180_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007756402 5.18E-06 NA mr1183_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007756402 NA 3.53E-10 mr1183_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007756402 6.77E-08 2.62E-14 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007756402 1.32E-07 NA mr1258_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007756402 2.69E-07 2.77E-09 mr1258_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007756402 NA 1.48E-07 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007756402 1.74E-10 NA mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007756402 1.05E-11 3.10E-25 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007756402 NA 2.21E-08 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007756402 5.91E-10 9.56E-25 mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007756402 3.72E-08 3.91E-19 mr1794_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007756402 NA 7.04E-07 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007756402 NA 4.41E-07 mr1961_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251