\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1007689790:

Variant ID: vg1007689790 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 7689790
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.01, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


AGGTAGCTCTACTCTTCCATAACCAAATGAAATATTGCGGTGGCTGCAGGGCACTAAAGTTTAAAGCATAAAACTTCTAAGATGAATATTTCAAATTCCC[C/A]
AGATATAAGCCCATGTATCATATTCCTATGAGATGTTTACCTCTTCTAACATCTGAGATAAAGACTGATACTCTTCAAAAGCTTGCTGAGAAAGAGGCAA

Reverse complement sequence

TTGCCTCTTTCTCAGCAAGCTTTTGAAGAGTATCAGTCTTTATCTCAGATGTTAGAAGAGGTAAACATCTCATAGGAATATGATACATGGGCTTATATCT[G/T]
GGGAATTTGAAATATTCATCTTAGAAGTTTTATGCTTTAAACTTTAGTGCCCTGCAGCCACCGCAATATTTCATTTGGTTATGGAAGAGTAGAGCTACCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.80% 19.20% 0.02% 0.00% NA
All Indica  2759 75.10% 24.80% 0.04% 0.00% NA
All Japonica  1512 86.20% 13.80% 0.00% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 98.30% 1.50% 0.17% 0.00% NA
Indica II  465 77.40% 22.60% 0.00% 0.00% NA
Indica III  913 55.90% 44.10% 0.00% 0.00% NA
Indica Intermediate  786 78.60% 21.40% 0.00% 0.00% NA
Temperate Japonica  767 95.30% 4.70% 0.00% 0.00% NA
Tropical Japonica  504 77.40% 22.60% 0.00% 0.00% NA
Japonica Intermediate  241 75.50% 24.50% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1007689790 C -> A LOC_Os10g14180.3 5_prime_UTR_variant ; 3024.0bp to feature; MODIFIER silent_mutation Average:53.554; most accessible tissue: Callus, score: 88.86 N N N N
vg1007689790 C -> A LOC_Os10g14180.4 5_prime_UTR_variant ; 3024.0bp to feature; MODIFIER silent_mutation Average:53.554; most accessible tissue: Callus, score: 88.86 N N N N
vg1007689790 C -> A LOC_Os10g14180.5 5_prime_UTR_variant ; 3024.0bp to feature; MODIFIER silent_mutation Average:53.554; most accessible tissue: Callus, score: 88.86 N N N N
vg1007689790 C -> A LOC_Os10g14180.6 5_prime_UTR_variant ; 3024.0bp to feature; MODIFIER silent_mutation Average:53.554; most accessible tissue: Callus, score: 88.86 N N N N
vg1007689790 C -> A LOC_Os10g14180.7 5_prime_UTR_variant ; 3024.0bp to feature; MODIFIER silent_mutation Average:53.554; most accessible tissue: Callus, score: 88.86 N N N N
vg1007689790 C -> A LOC_Os10g14180.8 5_prime_UTR_variant ; 3024.0bp to feature; MODIFIER silent_mutation Average:53.554; most accessible tissue: Callus, score: 88.86 N N N N
vg1007689790 C -> A LOC_Os10g14180.9 5_prime_UTR_variant ; 3024.0bp to feature; MODIFIER silent_mutation Average:53.554; most accessible tissue: Callus, score: 88.86 N N N N
vg1007689790 C -> A LOC_Os10g14180.2 5_prime_UTR_variant ; 3024.0bp to feature; MODIFIER silent_mutation Average:53.554; most accessible tissue: Callus, score: 88.86 N N N N
vg1007689790 C -> A LOC_Os10g14170.1 upstream_gene_variant ; 3810.0bp to feature; MODIFIER silent_mutation Average:53.554; most accessible tissue: Callus, score: 88.86 N N N N
vg1007689790 C -> A LOC_Os10g14180.1 upstream_gene_variant ; 2860.0bp to feature; MODIFIER silent_mutation Average:53.554; most accessible tissue: Callus, score: 88.86 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1007689790 3.07E-06 7.51E-13 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007689790 1.08E-06 NA mr1110 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007689790 1.36E-07 3.30E-12 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007689790 5.55E-08 6.11E-12 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007689790 3.35E-07 NA mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007689790 2.26E-08 6.98E-13 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007689790 1.21E-06 1.41E-15 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007689790 1.05E-10 1.74E-21 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007689790 2.64E-06 3.22E-10 mr1119 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007689790 5.59E-06 4.44E-08 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007689790 6.05E-06 1.66E-12 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007689790 NA 1.40E-14 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007689790 NA 1.54E-09 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007689790 1.51E-08 5.55E-12 mr1247 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007689790 5.27E-09 NA mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007689790 3.97E-11 4.65E-26 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007689790 NA 1.01E-06 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007689790 NA 5.36E-07 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007689790 NA 2.52E-14 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007689790 NA 7.66E-09 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007689790 2.46E-06 4.20E-15 mr1794 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007689790 NA 3.41E-11 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007689790 NA 3.57E-06 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007689790 1.91E-06 3.16E-08 mr1917 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007689790 NA 3.73E-06 mr1936 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007689790 7.05E-08 1.56E-14 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007689790 1.16E-07 8.05E-15 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007689790 9.65E-07 1.95E-11 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007689790 7.84E-07 1.04E-15 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007689790 6.31E-09 2.28E-21 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007689790 NA 2.78E-06 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007689790 2.31E-06 7.49E-11 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007689790 4.59E-08 5.95E-15 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007689790 6.74E-07 NA mr1161_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007689790 2.52E-07 1.37E-12 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007689790 NA 2.70E-07 mr1183_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007689790 3.16E-07 1.47E-13 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007689790 8.02E-08 NA mr1258_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007689790 1.81E-07 1.88E-09 mr1258_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007689790 3.82E-09 NA mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007689790 1.57E-09 1.64E-24 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007689790 NA 2.21E-08 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007689790 3.53E-07 1.14E-21 mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007689790 NA 1.84E-15 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007689790 NA 1.44E-07 mr1961_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251