| Variant ID: vg1007689790 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 7689790 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.01, others allele: 0.00, population size: 268. )
AGGTAGCTCTACTCTTCCATAACCAAATGAAATATTGCGGTGGCTGCAGGGCACTAAAGTTTAAAGCATAAAACTTCTAAGATGAATATTTCAAATTCCC[C/A]
AGATATAAGCCCATGTATCATATTCCTATGAGATGTTTACCTCTTCTAACATCTGAGATAAAGACTGATACTCTTCAAAAGCTTGCTGAGAAAGAGGCAA
TTGCCTCTTTCTCAGCAAGCTTTTGAAGAGTATCAGTCTTTATCTCAGATGTTAGAAGAGGTAAACATCTCATAGGAATATGATACATGGGCTTATATCT[G/T]
GGGAATTTGAAATATTCATCTTAGAAGTTTTATGCTTTAAACTTTAGTGCCCTGCAGCCACCGCAATATTTCATTTGGTTATGGAAGAGTAGAGCTACCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.80% | 19.20% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 75.10% | 24.80% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 86.20% | 13.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.30% | 1.50% | 0.17% | 0.00% | NA |
| Indica II | 465 | 77.40% | 22.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 55.90% | 44.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 78.60% | 21.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 95.30% | 4.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 77.40% | 22.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 75.50% | 24.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 12.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1007689790 | C -> A | LOC_Os10g14180.3 | 5_prime_UTR_variant ; 3024.0bp to feature; MODIFIER | silent_mutation | Average:53.554; most accessible tissue: Callus, score: 88.86 | N | N | N | N |
| vg1007689790 | C -> A | LOC_Os10g14180.4 | 5_prime_UTR_variant ; 3024.0bp to feature; MODIFIER | silent_mutation | Average:53.554; most accessible tissue: Callus, score: 88.86 | N | N | N | N |
| vg1007689790 | C -> A | LOC_Os10g14180.5 | 5_prime_UTR_variant ; 3024.0bp to feature; MODIFIER | silent_mutation | Average:53.554; most accessible tissue: Callus, score: 88.86 | N | N | N | N |
| vg1007689790 | C -> A | LOC_Os10g14180.6 | 5_prime_UTR_variant ; 3024.0bp to feature; MODIFIER | silent_mutation | Average:53.554; most accessible tissue: Callus, score: 88.86 | N | N | N | N |
| vg1007689790 | C -> A | LOC_Os10g14180.7 | 5_prime_UTR_variant ; 3024.0bp to feature; MODIFIER | silent_mutation | Average:53.554; most accessible tissue: Callus, score: 88.86 | N | N | N | N |
| vg1007689790 | C -> A | LOC_Os10g14180.8 | 5_prime_UTR_variant ; 3024.0bp to feature; MODIFIER | silent_mutation | Average:53.554; most accessible tissue: Callus, score: 88.86 | N | N | N | N |
| vg1007689790 | C -> A | LOC_Os10g14180.9 | 5_prime_UTR_variant ; 3024.0bp to feature; MODIFIER | silent_mutation | Average:53.554; most accessible tissue: Callus, score: 88.86 | N | N | N | N |
| vg1007689790 | C -> A | LOC_Os10g14180.2 | 5_prime_UTR_variant ; 3024.0bp to feature; MODIFIER | silent_mutation | Average:53.554; most accessible tissue: Callus, score: 88.86 | N | N | N | N |
| vg1007689790 | C -> A | LOC_Os10g14170.1 | upstream_gene_variant ; 3810.0bp to feature; MODIFIER | silent_mutation | Average:53.554; most accessible tissue: Callus, score: 88.86 | N | N | N | N |
| vg1007689790 | C -> A | LOC_Os10g14180.1 | upstream_gene_variant ; 2860.0bp to feature; MODIFIER | silent_mutation | Average:53.554; most accessible tissue: Callus, score: 88.86 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1007689790 | 3.07E-06 | 7.51E-13 | mr1026 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007689790 | 1.08E-06 | NA | mr1110 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007689790 | 1.36E-07 | 3.30E-12 | mr1113 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007689790 | 5.55E-08 | 6.11E-12 | mr1114 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007689790 | 3.35E-07 | NA | mr1116 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007689790 | 2.26E-08 | 6.98E-13 | mr1116 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007689790 | 1.21E-06 | 1.41E-15 | mr1118 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007689790 | 1.05E-10 | 1.74E-21 | mr1118 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007689790 | 2.64E-06 | 3.22E-10 | mr1119 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007689790 | 5.59E-06 | 4.44E-08 | mr1120 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/