\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1007683620:

Variant ID: vg1007683620 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 7683620
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.01, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


ACATACCCGATTCAAATTTGAATTTGAATTCAAATTTTTTATATATAGTATTTCTATACATAAATTTTTCTAACTTTTATTTTTTTAAAAGTTTTTGTGG[T/C]
GTACTGTAGTAGGAAGAGAAGAAGGGGAGGAGGAAGGGAGAGAAGAGGGAGGAGCATAGGGGAAGGGCCAGCACTGGTGATCGCTTGGGCCAGCGCGGGG

Reverse complement sequence

CCCCGCGCTGGCCCAAGCGATCACCAGTGCTGGCCCTTCCCCTATGCTCCTCCCTCTTCTCTCCCTTCCTCCTCCCCTTCTTCTCTTCCTACTACAGTAC[A/G]
CCACAAAAACTTTTAAAAAAATAAAAGTTAGAAAAATTTATGTATAGAAATACTATATATAAAAAATTTGAATTCAAATTCAAATTTGAATCGGGTATGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.90% 20.80% 0.08% 0.15% NA
All Indica  2759 64.80% 34.80% 0.14% 0.25% NA
All Japonica  1512 99.10% 0.90% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 13.30% 85.40% 0.17% 1.18% NA
Indica II  465 83.40% 16.30% 0.22% 0.00% NA
Indica III  913 85.00% 15.00% 0.00% 0.00% NA
Indica Intermediate  786 69.50% 30.30% 0.25% 0.00% NA
Temperate Japonica  767 99.30% 0.70% 0.00% 0.00% NA
Tropical Japonica  504 98.80% 1.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 85.60% 14.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1007683620 T -> C LOC_Os10g14180.3 upstream_gene_variant ; 1601.0bp to feature; MODIFIER silent_mutation Average:64.125; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg1007683620 T -> C LOC_Os10g14180.4 upstream_gene_variant ; 1601.0bp to feature; MODIFIER silent_mutation Average:64.125; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg1007683620 T -> C LOC_Os10g14180.5 upstream_gene_variant ; 1601.0bp to feature; MODIFIER silent_mutation Average:64.125; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg1007683620 T -> C LOC_Os10g14180.6 upstream_gene_variant ; 1601.0bp to feature; MODIFIER silent_mutation Average:64.125; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg1007683620 T -> C LOC_Os10g14180.7 upstream_gene_variant ; 1601.0bp to feature; MODIFIER silent_mutation Average:64.125; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg1007683620 T -> C LOC_Os10g14180.8 upstream_gene_variant ; 1601.0bp to feature; MODIFIER silent_mutation Average:64.125; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg1007683620 T -> C LOC_Os10g14180.9 upstream_gene_variant ; 1601.0bp to feature; MODIFIER silent_mutation Average:64.125; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg1007683620 T -> C LOC_Os10g14180.2 upstream_gene_variant ; 1601.0bp to feature; MODIFIER silent_mutation Average:64.125; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg1007683620 T -> C LOC_Os10g14160.1 downstream_gene_variant ; 2242.0bp to feature; MODIFIER silent_mutation Average:64.125; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg1007683620 T -> C LOC_Os10g14170.1 downstream_gene_variant ; 1553.0bp to feature; MODIFIER silent_mutation Average:64.125; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg1007683620 T -> C LOC_Os10g14160-LOC_Os10g14170 intergenic_region ; MODIFIER silent_mutation Average:64.125; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg1007683620 T -> DEL N N silent_mutation Average:64.125; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1007683620 7.75E-10 3.11E-42 mr1026 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007683620 5.46E-09 3.93E-22 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007683620 6.45E-07 NA mr1110 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007683620 5.62E-06 NA mr1110 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007683620 NA 6.43E-07 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007683620 NA 2.86E-07 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007683620 NA 6.32E-06 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007683620 7.98E-08 2.38E-19 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007683620 1.56E-11 3.84E-23 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007683620 NA 4.73E-07 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007683620 NA 4.35E-06 mr1123 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007683620 3.05E-09 4.33E-39 mr1161 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007683620 1.14E-08 2.85E-20 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007683620 NA 5.02E-06 mr1242 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007683620 6.86E-09 2.02E-26 mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007683620 9.23E-12 2.37E-28 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007683620 6.40E-06 1.08E-11 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007683620 NA 4.52E-06 mr1789 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007683620 NA 8.11E-11 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007683620 NA 5.79E-07 mr1936 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007683620 6.25E-06 NA mr1110_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007683620 NA 3.77E-06 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007683620 NA 2.22E-06 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007683620 1.51E-06 5.19E-23 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007683620 1.41E-10 6.72E-29 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007683620 NA 5.64E-09 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007683620 NA 1.61E-07 mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007683620 3.90E-11 9.96E-43 mr1161_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007683620 2.91E-09 4.82E-23 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007683620 NA 1.63E-06 mr1242_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007683620 NA 7.95E-07 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007683620 2.02E-08 7.79E-33 mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007683620 1.88E-10 5.90E-31 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007683620 NA 1.13E-10 mr1496_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007683620 NA 3.01E-07 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007683620 4.21E-06 1.13E-16 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007683620 NA 2.07E-07 mr1904_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007683620 NA 3.26E-11 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007683620 NA 1.04E-07 mr1961_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251