Variant ID: vg1007626497 (JBrowse) | Variation Type: SNP |
Chromosome: chr10 | Position: 7626497 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.02, others allele: 0.00, population size: 254. )
TGCATCATTGAATACCCTCATGTCATGAACCGAACCAGGCCAGCCAGCAAGCACGAAAGTAAATCTCATATCAAAGTCACAGACAAACATAACATTCTGA[C/T]
TCTTCTCCTTATGTCTATTCCTATGTTGAACAGCAGCTGAATTTGGCACCACAACTTGGATGTGAGTACCATCTATTGCTCCAATGCAATTATCCAAATA
TATTTGGATAATTGCATTGGAGCAATAGATGGTACTCACATCCAAGTTGTGGTGCCAAATTCAGCTGCTGTTCAACATAGGAATAGACATAAGGAGAAGA[G/A]
TCAGAATGTTATGTTTGTCTGTGACTTTGATATGAGATTTACTTTCGTGCTTGCTGGCTGGCCTGGTTCGGTTCATGACATGAGGGTATTCAATGATGCA
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 93.70% | 6.20% | 0.08% | 0.00% | NA |
All Indica | 2759 | 99.90% | 0.00% | 0.04% | 0.00% | NA |
All Japonica | 1512 | 81.00% | 18.90% | 0.13% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
Temperate Japonica | 767 | 65.20% | 34.80% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 95.00% | 4.10% | 0.83% | 0.00% | NA |
VI/Aromatic | 96 | 93.80% | 5.20% | 1.04% | 0.00% | NA |
Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1007626497 | C -> T | LOC_Os10g14030.1 | missense_variant ; p.Ser464Asn; MODERATE | nonsynonymous_codon ; S464N | Average:24.904; most accessible tissue: Callus, score: 49.496 | possibly damaging ![]() |
1.849 ![]() |
DELETERIOUS | 0.00 |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1007626497 | NA | 2.62E-08 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1007626497 | NA | 1.23E-07 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1007626497 | 3.11E-06 | NA | mr1300 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1007626497 | 5.74E-06 | NA | mr1305 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1007626497 | NA | 2.03E-08 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1007626497 | NA | 5.80E-09 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1007626497 | 2.61E-06 | NA | mr1586 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1007626497 | NA | 5.79E-08 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1007626497 | NA | 4.71E-06 | mr1765 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1007626497 | NA | 2.44E-06 | mr1913 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/