Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1007607743:

Variant ID: vg1007607743 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 7607743
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.92, C: 0.10, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:

ACACTCAGCTTGTCAAATATTTCGGTTGCGTCGAGTGCACTCGGACCACCATTATTGAGGAACATGGCTTGGATAAGTGGTGCAGCGGCATTGGCGACGT[T/C]
ATCTCTTGCTCCTTCAAGCCTCTTGATCTTACCAACCAGGACGTCAAACTGAGCTTGAGATTTGATCTTGCGATCTACAAAACACATTTATAATAAGAAT

Reverse complement sequence

ATTCTTATTATAAATGTGTTTTGTAGATCGCAAGATCAAATCTCAAGCTCAGTTTGACGTCCTGGTTGGTAAGATCAAGAGGCTTGAAGGAGCAAGAGAT[A/G]
ACGTCGCCAATGCCGCTGCACCACTTATCCAAGCCATGTTCCTCAATAATGGTGGTCCGAGTGCACTCGACGCAACCGAAATATTTGACAAGCTGAGTGT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	24.20%	0.10%	5.31%	70.38%	NA
All Indica	2759	10.40%	0.10%	2.97%	86.52%	NA
All Japonica	1512	54.00%	0.10%	5.69%	40.28%	NA
Aus	269	1.10%	0.00%	0.74%	98.14%	NA
Indica I	595	7.40%	0.30%	3.36%	88.91%	NA
Indica II	465	13.50%	0.00%	4.52%	81.94%	NA
Indica III	913	3.60%	0.00%	2.19%	94.19%	NA
Indica Intermediate	786	18.70%	0.10%	2.67%	78.50%	NA
Temperate Japonica	767	79.90%	0.00%	0.91%	19.17%	NA
Tropical Japonica	504	12.10%	0.20%	13.10%	74.60%	NA
Japonica Intermediate	241	58.90%	0.00%	5.39%	35.68%	NA
VI/Aromatic	96	8.30%	0.00%	75.00%	16.67%	NA
Intermediate	90	34.40%	0.00%	10.00%	55.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1007607743	T -> C	LOC_Os10g13990.1	missense_variant ; p.Asn703Asp; MODERATE	nonsynonymous_codon	Average:7.391; most accessible tissue: Minghui63 young leaf, score: 12.713	benign	-0.134	DELETERIOUS	0.03
vg1007607743	T -> DEL	LOC_Os10g13990.1	N	frameshift_variant	Average:7.391; most accessible tissue: Minghui63 young leaf, score: 12.713	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1007607743	NA	2.64E-06	mr1068_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007607743	NA	9.36E-07	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007607743	NA	2.64E-06	mr1084_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007607743	4.97E-06	NA	mr1085_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007607743	NA	6.73E-06	mr1091_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007607743	NA	1.40E-06	mr1097_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007607743	7.80E-07	7.80E-07	mr1105_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007607743	NA	2.76E-06	mr1110_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007607743	6.68E-06	1.77E-07	mr1112_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007607743	NA	1.22E-07	mr1121_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007607743	NA	4.96E-06	mr1148_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007607743	4.68E-06	1.80E-07	mr1204_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007607743	NA	6.09E-06	mr1205_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007607743	NA	3.27E-07	mr1206_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007607743	4.22E-06	4.22E-06	mr1216_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007607743	NA	1.17E-06	mr1220_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007607743	5.21E-06	5.21E-06	mr1223_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007607743	NA	9.15E-06	mr1224_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007607743	3.76E-06	5.00E-08	mr1239_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007607743	NA	1.55E-06	mr1246_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007607743	8.20E-06	9.04E-08	mr1250_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007607743	NA	2.53E-06	mr1404_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007607743	NA	1.01E-06	mr1596_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007607743	9.25E-07	2.55E-07	mr1620_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007607743	NA	8.92E-06	mr1718_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007607743	4.42E-06	1.33E-07	mr1739_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007607743	NA	6.60E-06	mr1741_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007607743	2.83E-06	2.29E-07	mr1763_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007607743	6.54E-06	6.54E-06	mr1837_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007607743	NA	3.90E-07	mr1896_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007607743	NA	7.83E-06	mr1936_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251