Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1007555829:

Variant ID: vg1007555829 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 7555829
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.00, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:

TTGTCTTATTCTTGGCCTCCTCTTATGGTCACATGTTAAGTTTCTAAACTACTCCCTCCGTCCCCTAATATAAGGGATTTTGACATTTTGCTTTCAATGT[G/A]
TGATCATTCATCTTATTAAAAATTATTTATTTTATTTGTGACTTACTTTATTATCCAAAGTACTTTAAGCACAACTTTTTATTTTTTATATTTGCATAAA

Reverse complement sequence

TTTATGCAAATATAAAAAATAAAAAGTTGTGCTTAAAGTACTTTGGATAATAAAGTAAGTCACAAATAAAATAAATAATTTTTAATAAGATGAATGATCA[C/T]
ACATTGAAAGCAAAATGTCAAAATCCCTTATATTAGGGGACGGAGGGAGTAGTTTAGAAACTTAACATGTGACCATAAGAGGAGGCCAAGAATAAGACAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.80%	7.20%	0.00%	0.00%	NA
All Indica	2759	97.50%	2.50%	0.00%	0.00%	NA
All Japonica	1512	99.70%	0.30%	0.00%	0.00%	NA
Aus	269	3.00%	97.00%	0.00%	0.00%	NA
Indica I	595	98.70%	1.30%	0.00%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	98.00%	2.00%	0.00%	0.00%	NA
Indica Intermediate	786	95.00%	5.00%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.00%	1.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	93.30%	6.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1007555829	G -> A	LOC_Os10g13900.1	upstream_gene_variant ; 1046.0bp to feature; MODIFIER	silent_mutation	Average:53.453; most accessible tissue: Minghui63 flower, score: 68.526	N	N	N	N
vg1007555829	G -> A	LOC_Os10g13914.1	upstream_gene_variant ; 1490.0bp to feature; MODIFIER	silent_mutation	Average:53.453; most accessible tissue: Minghui63 flower, score: 68.526	N	N	N	N
vg1007555829	G -> A	LOC_Os10g13900-LOC_Os10g13914	intergenic_region ; MODIFIER	silent_mutation	Average:53.453; most accessible tissue: Minghui63 flower, score: 68.526	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1007555829	1.36E-06	NA	mr1026	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007555829	NA	5.74E-23	mr1095	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007555829	NA	2.23E-30	mr1098	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007555829	NA	1.31E-26	mr1099	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007555829	NA	1.46E-15	mr1158	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007555829	2.09E-06	NA	mr1161	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007555829	2.37E-06	NA	mr1261	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007555829	NA	1.15E-23	mr1305	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007555829	NA	1.74E-06	mr1762	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007555829	NA	2.84E-06	mr1803	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007555829	NA	2.39E-25	mr1858	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007555829	NA	2.16E-25	mr1859	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007555829	NA	2.86E-17	mr1911	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007555829	NA	1.78E-12	mr1918	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007555829	NA	2.94E-19	mr1961	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007555829	NA	1.60E-22	mr1095_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007555829	NA	9.04E-31	mr1098_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007555829	NA	1.09E-23	mr1099_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007555829	NA	4.99E-20	mr1305_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007555829	NA	6.72E-06	mr1522_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007555829	NA	1.45E-08	mr1707_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251