Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1007541987:

Variant ID: vg1007541987 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 7541987
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.79, A: 0.21, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


GGTTACAAAAAATGCAGGAAAAATGTTTAGACTGTCGAAGCAAATCCATCAGGAGGACACCATGGCATCTGATGTTGTCTACTATGCATCAAAGAGATTA[C/A]
TGGTTGTTTTTATTCCTTCTTTTTGGTTGAGATAATTTACGTTAATATAATGTTTTCATAGAAGTGAGCCAATCTTGATTTGTTTGGTTAACACGGGTTA

Reverse complement sequence

TAACCCGTGTTAACCAAACAAATCAAGATTGGCTCACTTCTATGAAAACATTATATTAACGTAAATTATCTCAACCAAAAAGAAGGAATAAAAACAACCA[G/T]
TAATCTCTTTGATGCATAGTAGACAACATCAGATGCCATGGTGTCCTCCTGATGGATTTGCTTCGACAGTCTAAACATTTTTCCTGCATTTTTTGTAACC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.90% 34.10% 0.02% 0.00% NA
All Indica  2759 64.70% 35.30% 0.00% 0.00% NA
All Japonica  1512 62.60% 37.30% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 14.50% 85.50% 0.00% 0.00% NA
Indica II  465 84.30% 15.70% 0.00% 0.00% NA
Indica III  913 83.20% 16.80% 0.00% 0.00% NA
Indica Intermediate  786 69.70% 30.30% 0.00% 0.00% NA
Temperate Japonica  767 58.30% 41.60% 0.13% 0.00% NA
Tropical Japonica  504 58.70% 41.30% 0.00% 0.00% NA
Japonica Intermediate  241 84.60% 15.40% 0.00% 0.00% NA
VI/Aromatic  96 52.10% 47.90% 0.00% 0.00% NA
Intermediate  90 70.00% 30.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1007541987 C -> A LOC_Os10g13870.1 upstream_gene_variant ; 2711.0bp to feature; MODIFIER silent_mutation Average:29.544; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg1007541987 C -> A LOC_Os10g13880.1 downstream_gene_variant ; 1948.0bp to feature; MODIFIER silent_mutation Average:29.544; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg1007541987 C -> A LOC_Os10g13870-LOC_Os10g13880 intergenic_region ; MODIFIER silent_mutation Average:29.544; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1007541987 8.44E-06 NA mr1026 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007541987 9.84E-10 1.24E-22 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007541987 NA 1.79E-08 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007541987 8.52E-06 2.22E-08 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007541987 NA 4.45E-07 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007541987 3.13E-06 NA mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007541987 3.82E-11 5.77E-24 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007541987 8.38E-06 NA mr1120 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007541987 1.26E-07 2.61E-10 mr1120 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007541987 3.87E-06 NA mr1161 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007541987 3.56E-10 8.71E-22 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007541987 NA 3.94E-06 mr1242 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007541987 NA 3.44E-06 mr1247 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007541987 5.23E-07 NA mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007541987 1.15E-09 4.47E-28 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007541987 NA 7.93E-11 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007541987 NA 1.01E-06 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007541987 7.54E-08 6.38E-12 mr1794 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007541987 7.54E-07 7.72E-14 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007541987 NA 8.47E-06 mr1917 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007541987 NA 4.46E-06 mr1922 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007541987 NA 1.24E-06 mr1936 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007541987 NA 1.30E-07 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007541987 NA 8.16E-08 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007541987 NA 4.66E-06 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007541987 1.04E-10 5.01E-30 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007541987 NA 5.98E-06 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007541987 3.11E-06 1.53E-10 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007541987 NA 1.36E-07 mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007541987 8.41E-07 2.97E-20 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007541987 NA 7.10E-08 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007541987 1.53E-06 NA mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007541987 7.39E-10 1.14E-31 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007541987 NA 4.40E-10 mr1496_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007541987 NA 5.26E-08 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007541987 NA 3.36E-13 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007541987 NA 4.32E-16 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007541987 NA 3.39E-11 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007541987 NA 1.14E-06 mr1961_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251