Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1007540239:

Variant ID: vg1007540239 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 7540239
Reference Allele: C	Alternative Allele: A,G
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTATTTGGCCAAGCACTATGGCTAAAATGGCATGCCAAGCTTGGAACAGAAAGGTCAAGCAATTTTTCCAACCACGGTGCAGCACGTGGCAATGGCACTA[C/A,G]
CACTAATTTCTATCATATGTAGGAAGATCCAAGTTGATGCTAGCACAGGCTTTGGTGAATCACTGATGGGTGAGAGACCTGCAGAGTTCCTTGTCCAACA

Reverse complement sequence

TGTTGGACAAGGAACTCTGCAGGTCTCTCACCCATCAGTGATTCACCAAAGCCTGTGCTAGCATCAACTTGGATCTTCCTACATATGATAGAAATTAGTG[G/T,C]
TAGTGCCATTGCCACGTGCTGCACCGTGGTTGGAAAAATTGCTTGACCTTTCTGTTCCAAGCTTGGCATGCCATTTTAGCCATAGTGCTTGGCCAAATAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.80%	3.10%	4.53%	23.28%	G: 0.25%
All Indica	2759	66.00%	5.10%	6.74%	21.64%	G: 0.43%
All Japonica	1512	68.70%	0.10%	0.53%	30.62%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	17.10%	7.10%	16.47%	58.82%	G: 0.50%
Indica II	465	85.40%	1.90%	4.73%	7.96%	NA
Indica III	913	83.00%	6.00%	3.07%	7.34%	G: 0.55%
Indica Intermediate	786	71.90%	4.60%	4.83%	18.19%	G: 0.51%
Temperate Japonica	767	65.30%	0.00%	0.13%	34.55%	NA
Tropical Japonica	504	65.30%	0.40%	1.39%	32.94%	NA
Japonica Intermediate	241	86.70%	0.00%	0.00%	13.28%	NA
VI/Aromatic	96	60.40%	1.00%	17.71%	20.83%	NA
Intermediate	90	71.10%	3.30%	3.33%	22.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1007540239	C -> G	LOC_Os10g13870.1	upstream_gene_variant ; 963.0bp to feature; MODIFIER	silent_mutation	Average:38.748; most accessible tissue: Minghui63 young leaf, score: 65.92	N	N	N	N
vg1007540239	C -> G	LOC_Os10g13880.1	downstream_gene_variant ; 3696.0bp to feature; MODIFIER	silent_mutation	Average:38.748; most accessible tissue: Minghui63 young leaf, score: 65.92	N	N	N	N
vg1007540239	C -> G	LOC_Os10g13870-LOC_Os10g13880	intergenic_region ; MODIFIER	silent_mutation	Average:38.748; most accessible tissue: Minghui63 young leaf, score: 65.92	N	N	N	N
vg1007540239	C -> A	LOC_Os10g13870.1	upstream_gene_variant ; 963.0bp to feature; MODIFIER	silent_mutation	Average:38.748; most accessible tissue: Minghui63 young leaf, score: 65.92	N	N	N	N
vg1007540239	C -> A	LOC_Os10g13880.1	downstream_gene_variant ; 3696.0bp to feature; MODIFIER	silent_mutation	Average:38.748; most accessible tissue: Minghui63 young leaf, score: 65.92	N	N	N	N
vg1007540239	C -> A	LOC_Os10g13870-LOC_Os10g13880	intergenic_region ; MODIFIER	silent_mutation	Average:38.748; most accessible tissue: Minghui63 young leaf, score: 65.92	N	N	N	N
vg1007540239	C -> DEL	N	N	silent_mutation	Average:38.748; most accessible tissue: Minghui63 young leaf, score: 65.92	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1007540239	2.00E-07	2.98E-22	mr1026	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007540239	NA	2.86E-08	mr1113	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007540239	2.26E-07	4.02E-09	mr1114	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007540239	4.26E-06	7.66E-08	mr1116	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007540239	6.87E-06	NA	mr1118	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007540239	3.98E-12	1.35E-23	mr1118	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007540239	NA	6.26E-06	mr1119	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007540239	NA	1.87E-08	mr1120	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007540239	1.11E-07	2.53E-21	mr1161	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007540239	5.28E-06	NA	mr1183	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007540239	NA	9.07E-07	mr1183	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007540239	NA	8.36E-06	mr1242	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007540239	NA	5.40E-06	mr1247	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007540239	8.88E-09	NA	mr1495	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007540239	3.26E-14	7.10E-31	mr1495	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007540239	NA	1.11E-10	mr1496	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007540239	1.35E-06	NA	mr1503	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007540239	9.00E-06	3.25E-07	mr1503	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007540239	3.81E-10	1.75E-13	mr1794	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007540239	3.30E-09	2.26E-15	mr1794	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007540239	NA	9.47E-06	mr1917	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007540239	NA	2.73E-07	mr1936	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007540239	NA	2.48E-06	mr1113_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007540239	NA	2.66E-06	mr1114_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007540239	6.73E-06	NA	mr1118_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007540239	1.02E-11	4.09E-29	mr1118_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007540239	NA	2.00E-08	mr1120_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007540239	NA	5.63E-08	mr1123_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007540239	4.79E-06	NA	mr1161_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007540239	2.25E-09	4.10E-22	mr1161_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007540239	NA	4.59E-06	mr1247_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007540239	2.34E-08	NA	mr1495_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007540239	1.06E-11	1.09E-31	mr1495_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007540239	NA	1.79E-10	mr1496_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007540239	NA	1.30E-07	mr1531_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007540239	NA	3.83E-13	mr1709_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007540239	NA	7.78E-15	mr1794_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007540239	NA	1.74E-07	mr1904_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007540239	NA	1.88E-11	mr1936_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007540239	NA	2.00E-06	mr1961_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251