\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1007489797:

Variant ID: vg1007489797 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 7489797
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGCCGGTCTGACCGCCGGTGTCTCACCGGTTAGACCGCCGAACCCGAGCAAACACAACTCGAAGAACTCTAGATGTAGATGACAACTTTATTACTTCTCT[C/A]
TGTGTTTACAAAGTGCAACAACAGCACTCCTCATGAAAATTTCGACTAAACTCGAAACCCTAACTCAACTATTAATTCAATGCTCTCATAAGAGATACCG

Reverse complement sequence

CGGTATCTCTTATGAGAGCATTGAATTAATAGTTGAGTTAGGGTTTCGAGTTTAGTCGAAATTTTCATGAGGAGTGCTGTTGTTGCACTTTGTAAACACA[G/T]
AGAGAAGTAATAAAGTTGTCATCTACATCTAGAGTTCTTCGAGTTGTGTTTGCTCGGGTTCGGCGGTCTAACCGGTGAGACACCGGCGGTCAGACCGGCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.70% 3.30% 5.82% 25.20% NA
All Indica  2759 68.90% 2.60% 6.92% 21.60% NA
All Japonica  1512 52.50% 5.20% 5.29% 36.97% NA
Aus  269 99.30% 0.40% 0.00% 0.37% NA
Indica I  595 30.80% 0.50% 13.45% 55.29% NA
Indica II  465 82.80% 1.10% 4.09% 12.04% NA
Indica III  913 84.20% 5.00% 3.61% 7.12% NA
Indica Intermediate  786 71.80% 2.20% 7.51% 18.58% NA
Temperate Japonica  767 59.30% 0.00% 1.17% 39.50% NA
Tropical Japonica  504 36.90% 14.30% 11.90% 36.90% NA
Japonica Intermediate  241 63.50% 2.90% 4.56% 29.05% NA
VI/Aromatic  96 78.10% 1.00% 3.12% 17.71% NA
Intermediate  90 74.40% 4.40% 1.11% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1007489797 C -> A LOC_Os10g13770.1 upstream_gene_variant ; 409.0bp to feature; MODIFIER silent_mutation Average:16.893; most accessible tissue: Callus, score: 44.827 N N N N
vg1007489797 C -> A LOC_Os10g13780.1 upstream_gene_variant ; 1752.0bp to feature; MODIFIER silent_mutation Average:16.893; most accessible tissue: Callus, score: 44.827 N N N N
vg1007489797 C -> A LOC_Os10g13790.1 downstream_gene_variant ; 2999.0bp to feature; MODIFIER silent_mutation Average:16.893; most accessible tissue: Callus, score: 44.827 N N N N
vg1007489797 C -> A LOC_Os10g13770-LOC_Os10g13780 intergenic_region ; MODIFIER silent_mutation Average:16.893; most accessible tissue: Callus, score: 44.827 N N N N
vg1007489797 C -> DEL N N silent_mutation Average:16.893; most accessible tissue: Callus, score: 44.827 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1007489797 NA 9.66E-07 mr1134 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007489797 NA 1.53E-06 mr1135 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007489797 NA 1.65E-06 mr1504 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007489797 9.41E-07 1.94E-08 mr1134_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251