Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1007489401:

Variant ID: vg1007489401 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 7489401
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCATAATGTAAGATTGCATCTTATCACACCAATAAGCAAAATCCGAACCATCGAAAACATGGGGCTTAGTTGTAAACTTGTTAGCCATGGCTAAAAACTC[T/A]
AGATCGGTTAAAATCCAAAGAAGAAGAAAACAATGCTTTGATACCACTTGTAGGATCGACTAGAAAGAACTAAGCCAACCAGAGGGGGGTGAATGATTGG

Reverse complement sequence

CCAATCATTCACCCCCCTCTGGTTGGCTTAGTTCTTTCTAGTCGATCCTACAAGTGGTATCAAAGCATTGTTTTCTTCTTCTTTGGATTTTAACCGATCT[A/T]
GAGTTTTTAGCCATGGCTAACAAGTTTACAACTAAGCCCCATGTTTTCGATGGTTCGGATTTTGCTTATTGGTGTGATAAGATGCAATCTTACATTATGG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.70%	0.70%	5.88%	29.73%	NA
All Indica	2759	68.40%	1.10%	6.13%	24.47%	NA
All Japonica	1512	61.00%	0.00%	2.31%	36.71%	NA
Aus	269	33.50%	0.70%	26.39%	39.41%	NA
Indica I	595	32.90%	3.70%	16.13%	47.23%	NA
Indica II	465	81.30%	0.00%	2.37%	16.34%	NA
Indica III	913	82.00%	0.70%	2.85%	14.46%	NA
Indica Intermediate	786	71.60%	0.10%	4.58%	23.66%	NA
Temperate Japonica	767	58.10%	0.00%	0.26%	41.59%	NA
Tropical Japonica	504	62.10%	0.00%	5.16%	32.74%	NA
Japonica Intermediate	241	67.60%	0.00%	2.90%	29.46%	NA
VI/Aromatic	96	53.10%	0.00%	2.08%	44.79%	NA
Intermediate	90	70.00%	0.00%	1.11%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1007489401	T -> A	LOC_Os10g13770.1	upstream_gene_variant ; 13.0bp to feature; MODIFIER	silent_mutation	Average:9.086; most accessible tissue: Zhenshan97 young leaf, score: 17.571	N	N	N	N
vg1007489401	T -> A	LOC_Os10g13780.1	upstream_gene_variant ; 2148.0bp to feature; MODIFIER	silent_mutation	Average:9.086; most accessible tissue: Zhenshan97 young leaf, score: 17.571	N	N	N	N
vg1007489401	T -> A	LOC_Os10g13790.1	downstream_gene_variant ; 3395.0bp to feature; MODIFIER	silent_mutation	Average:9.086; most accessible tissue: Zhenshan97 young leaf, score: 17.571	N	N	N	N
vg1007489401	T -> A	LOC_Os10g13770-LOC_Os10g13780	intergenic_region ; MODIFIER	silent_mutation	Average:9.086; most accessible tissue: Zhenshan97 young leaf, score: 17.571	N	N	N	N
vg1007489401	T -> DEL	N	N	silent_mutation	Average:9.086; most accessible tissue: Zhenshan97 young leaf, score: 17.571	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1007489401	NA	1.69E-14	mr1026	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007489401	NA	6.54E-06	mr1100	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007489401	NA	6.16E-13	mr1161	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007489401	NA	3.31E-11	mr1495	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007489401	NA	1.15E-06	mr1962	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007489401	NA	1.66E-07	mr1075_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007489401	NA	3.53E-08	mr1100_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007489401	NA	3.64E-07	mr1149_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007489401	NA	2.24E-07	mr1212_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007489401	NA	2.25E-06	mr1486_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007489401	NA	1.56E-12	mr1495_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007489401	NA	1.84E-07	mr1619_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007489401	NA	1.09E-07	mr1795_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007489401	NA	7.05E-07	mr1936_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007489401	NA	4.22E-12	mr1962_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251