\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1007489401:

Variant ID: vg1007489401 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 7489401
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCATAATGTAAGATTGCATCTTATCACACCAATAAGCAAAATCCGAACCATCGAAAACATGGGGCTTAGTTGTAAACTTGTTAGCCATGGCTAAAAACTC[T/A]
AGATCGGTTAAAATCCAAAGAAGAAGAAAACAATGCTTTGATACCACTTGTAGGATCGACTAGAAAGAACTAAGCCAACCAGAGGGGGGTGAATGATTGG

Reverse complement sequence

CCAATCATTCACCCCCCTCTGGTTGGCTTAGTTCTTTCTAGTCGATCCTACAAGTGGTATCAAAGCATTGTTTTCTTCTTCTTTGGATTTTAACCGATCT[A/T]
GAGTTTTTAGCCATGGCTAACAAGTTTACAACTAAGCCCCATGTTTTCGATGGTTCGGATTTTGCTTATTGGTGTGATAAGATGCAATCTTACATTATGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.70% 0.70% 5.88% 29.73% NA
All Indica  2759 68.40% 1.10% 6.13% 24.47% NA
All Japonica  1512 61.00% 0.00% 2.31% 36.71% NA
Aus  269 33.50% 0.70% 26.39% 39.41% NA
Indica I  595 32.90% 3.70% 16.13% 47.23% NA
Indica II  465 81.30% 0.00% 2.37% 16.34% NA
Indica III  913 82.00% 0.70% 2.85% 14.46% NA
Indica Intermediate  786 71.60% 0.10% 4.58% 23.66% NA
Temperate Japonica  767 58.10% 0.00% 0.26% 41.59% NA
Tropical Japonica  504 62.10% 0.00% 5.16% 32.74% NA
Japonica Intermediate  241 67.60% 0.00% 2.90% 29.46% NA
VI/Aromatic  96 53.10% 0.00% 2.08% 44.79% NA
Intermediate  90 70.00% 0.00% 1.11% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1007489401 T -> A LOC_Os10g13770.1 upstream_gene_variant ; 13.0bp to feature; MODIFIER silent_mutation Average:9.086; most accessible tissue: Zhenshan97 young leaf, score: 17.571 N N N N
vg1007489401 T -> A LOC_Os10g13780.1 upstream_gene_variant ; 2148.0bp to feature; MODIFIER silent_mutation Average:9.086; most accessible tissue: Zhenshan97 young leaf, score: 17.571 N N N N
vg1007489401 T -> A LOC_Os10g13790.1 downstream_gene_variant ; 3395.0bp to feature; MODIFIER silent_mutation Average:9.086; most accessible tissue: Zhenshan97 young leaf, score: 17.571 N N N N
vg1007489401 T -> A LOC_Os10g13770-LOC_Os10g13780 intergenic_region ; MODIFIER silent_mutation Average:9.086; most accessible tissue: Zhenshan97 young leaf, score: 17.571 N N N N
vg1007489401 T -> DEL N N silent_mutation Average:9.086; most accessible tissue: Zhenshan97 young leaf, score: 17.571 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1007489401 NA 1.69E-14 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007489401 NA 6.54E-06 mr1100 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007489401 NA 6.16E-13 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007489401 NA 3.31E-11 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007489401 NA 1.15E-06 mr1962 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007489401 NA 1.66E-07 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007489401 NA 3.53E-08 mr1100_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007489401 NA 3.64E-07 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007489401 NA 2.24E-07 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007489401 NA 2.25E-06 mr1486_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007489401 NA 1.56E-12 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007489401 NA 1.84E-07 mr1619_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007489401 NA 1.09E-07 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007489401 NA 7.05E-07 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007489401 NA 4.22E-12 mr1962_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251