\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1007480591:

Variant ID: vg1007480591 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 7480591
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCGTCCAAGGATCGCCGCCGAAGTCGTCCCCTCCCCGTTCGTCTCCATAGTTCCCGGCCGCCTCCGCCGCGCCCGGTCGTCGTTGTTGTTCCCACGCCT[C/T]
GTCGCGTGGTGGTAAGGATCTCTCCTCTCGCTGCCCCGTCCTCGTCCTTTCGGTGTCGCCCCGTACCCGTTGTGCGGTCGTCGACCCCGGTACCCGTGTA

Reverse complement sequence

TACACGGGTACCGGGGTCGACGACCGCACAACGGGTACGGGGCGACACCGAAAGGACGAGGACGGGGCAGCGAGAGGAGAGATCCTTACCACCACGCGAC[G/A]
AGGCGTGGGAACAACAACGACGACCGGGCGCGGCGGAGGCGGCCGGGAACTATGGAGACGAACGGGGAGGGGACGACTTCGGCGGCGATCCTTGGACGAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.80% 0.90% 5.04% 54.21% NA
All Indica  2759 33.00% 1.60% 5.58% 59.84% NA
All Japonica  1512 47.50% 0.00% 0.93% 51.59% NA
Aus  269 60.20% 0.00% 23.05% 16.73% NA
Indica I  595 12.40% 2.20% 6.39% 78.99% NA
Indica II  465 24.90% 0.00% 4.09% 70.97% NA
Indica III  913 48.80% 1.90% 5.70% 43.59% NA
Indica Intermediate  786 35.00% 1.70% 5.73% 57.63% NA
Temperate Japonica  767 57.20% 0.00% 0.26% 42.50% NA
Tropical Japonica  504 28.20% 0.00% 1.98% 69.84% NA
Japonica Intermediate  241 56.80% 0.00% 0.83% 42.32% NA
VI/Aromatic  96 50.00% 0.00% 1.04% 48.96% NA
Intermediate  90 48.90% 0.00% 7.78% 43.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1007480591 C -> T LOC_Os10g13760.1 upstream_gene_variant ; 403.0bp to feature; MODIFIER silent_mutation Average:14.981; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg1007480591 C -> T LOC_Os10g13770.1 downstream_gene_variant ; 1759.0bp to feature; MODIFIER silent_mutation Average:14.981; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg1007480591 C -> T LOC_Os10g13760-LOC_Os10g13770 intergenic_region ; MODIFIER silent_mutation Average:14.981; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg1007480591 C -> DEL N N silent_mutation Average:14.981; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1007480591 5.39E-06 3.98E-06 mr1269 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007480591 3.80E-06 3.55E-06 mr1479 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251