Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1007480591:

Variant ID: vg1007480591 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 7480591
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTCGTCCAAGGATCGCCGCCGAAGTCGTCCCCTCCCCGTTCGTCTCCATAGTTCCCGGCCGCCTCCGCCGCGCCCGGTCGTCGTTGTTGTTCCCACGCCT[C/T]
GTCGCGTGGTGGTAAGGATCTCTCCTCTCGCTGCCCCGTCCTCGTCCTTTCGGTGTCGCCCCGTACCCGTTGTGCGGTCGTCGACCCCGGTACCCGTGTA

Reverse complement sequence

TACACGGGTACCGGGGTCGACGACCGCACAACGGGTACGGGGCGACACCGAAAGGACGAGGACGGGGCAGCGAGAGGAGAGATCCTTACCACCACGCGAC[G/A]
AGGCGTGGGAACAACAACGACGACCGGGCGCGGCGGAGGCGGCCGGGAACTATGGAGACGAACGGGGAGGGGACGACTTCGGCGGCGATCCTTGGACGAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.80%	0.90%	5.04%	54.21%	NA
All Indica	2759	33.00%	1.60%	5.58%	59.84%	NA
All Japonica	1512	47.50%	0.00%	0.93%	51.59%	NA
Aus	269	60.20%	0.00%	23.05%	16.73%	NA
Indica I	595	12.40%	2.20%	6.39%	78.99%	NA
Indica II	465	24.90%	0.00%	4.09%	70.97%	NA
Indica III	913	48.80%	1.90%	5.70%	43.59%	NA
Indica Intermediate	786	35.00%	1.70%	5.73%	57.63%	NA
Temperate Japonica	767	57.20%	0.00%	0.26%	42.50%	NA
Tropical Japonica	504	28.20%	0.00%	1.98%	69.84%	NA
Japonica Intermediate	241	56.80%	0.00%	0.83%	42.32%	NA
VI/Aromatic	96	50.00%	0.00%	1.04%	48.96%	NA
Intermediate	90	48.90%	0.00%	7.78%	43.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1007480591	C -> T	LOC_Os10g13760.1	upstream_gene_variant ; 403.0bp to feature; MODIFIER	silent_mutation	Average:14.981; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg1007480591	C -> T	LOC_Os10g13770.1	downstream_gene_variant ; 1759.0bp to feature; MODIFIER	silent_mutation	Average:14.981; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg1007480591	C -> T	LOC_Os10g13760-LOC_Os10g13770	intergenic_region ; MODIFIER	silent_mutation	Average:14.981; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg1007480591	C -> DEL	N	N	silent_mutation	Average:14.981; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1007480591	5.39E-06	3.98E-06	mr1269	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007480591	3.80E-06	3.55E-06	mr1479	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251