\
| Variant ID: vg1007480591 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 7480591 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTCGTCCAAGGATCGCCGCCGAAGTCGTCCCCTCCCCGTTCGTCTCCATAGTTCCCGGCCGCCTCCGCCGCGCCCGGTCGTCGTTGTTGTTCCCACGCCT[C/T]
GTCGCGTGGTGGTAAGGATCTCTCCTCTCGCTGCCCCGTCCTCGTCCTTTCGGTGTCGCCCCGTACCCGTTGTGCGGTCGTCGACCCCGGTACCCGTGTA
TACACGGGTACCGGGGTCGACGACCGCACAACGGGTACGGGGCGACACCGAAAGGACGAGGACGGGGCAGCGAGAGGAGAGATCCTTACCACCACGCGAC[G/A]
AGGCGTGGGAACAACAACGACGACCGGGCGCGGCGGAGGCGGCCGGGAACTATGGAGACGAACGGGGAGGGGACGACTTCGGCGGCGATCCTTGGACGAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.80% | 0.90% | 5.04% | 54.21% | NA |
| All Indica | 2759 | 33.00% | 1.60% | 5.58% | 59.84% | NA |
| All Japonica | 1512 | 47.50% | 0.00% | 0.93% | 51.59% | NA |
| Aus | 269 | 60.20% | 0.00% | 23.05% | 16.73% | NA |
| Indica I | 595 | 12.40% | 2.20% | 6.39% | 78.99% | NA |
| Indica II | 465 | 24.90% | 0.00% | 4.09% | 70.97% | NA |
| Indica III | 913 | 48.80% | 1.90% | 5.70% | 43.59% | NA |
| Indica Intermediate | 786 | 35.00% | 1.70% | 5.73% | 57.63% | NA |
| Temperate Japonica | 767 | 57.20% | 0.00% | 0.26% | 42.50% | NA |
| Tropical Japonica | 504 | 28.20% | 0.00% | 1.98% | 69.84% | NA |
| Japonica Intermediate | 241 | 56.80% | 0.00% | 0.83% | 42.32% | NA |
| VI/Aromatic | 96 | 50.00% | 0.00% | 1.04% | 48.96% | NA |
| Intermediate | 90 | 48.90% | 0.00% | 7.78% | 43.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1007480591 | C -> T | LOC_Os10g13760.1 | upstream_gene_variant ; 403.0bp to feature; MODIFIER | silent_mutation | Average:14.981; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg1007480591 | C -> T | LOC_Os10g13770.1 | downstream_gene_variant ; 1759.0bp to feature; MODIFIER | silent_mutation | Average:14.981; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg1007480591 | C -> T | LOC_Os10g13760-LOC_Os10g13770 | intergenic_region ; MODIFIER | silent_mutation | Average:14.981; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg1007480591 | C -> DEL | N | N | silent_mutation | Average:14.981; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1007480591 | 5.39E-06 | 3.98E-06 | mr1269 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007480591 | 3.80E-06 | 3.55E-06 | mr1479 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |