\
| Variant ID: vg1007457578 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 7457578 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.81, A: 0.17, others allele: 0.00, population size: 182. )
CTGAAAATTTCATTTGAAGAATTTCCTCAAAATTCAAAGATCCTAAATGCAATTTTGAAATTCAAACATGTATTGATGCAAAAATTTCAATTGTGGAAAA[C/A]
AAATATGCAGATACATACCAATTTACCTGTTGGCGAAGGTTGCGTCATTTTAAGTCCGACGTGCAAGACCGTACCTCCTTCCAGTTTAGTTCGCGGATTT
AAATCCGCGAACTAAACTGGAAGGAGGTACGGTCTTGCACGTCGGACTTAAAATGACGCAACCTTCGCCAACAGGTAAATTGGTATGTATCTGCATATTT[G/T]
TTTTCCACAATTGAAATTTTTGCATCAATACATGTTTGAATTTCAAAATTGCATTTAGGATCTTTGAATTTTGAGGAAATTCTTCAAATGAAATTTTCAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.50% | 31.20% | 0.25% | 0.00% | NA |
| All Indica | 2759 | 71.90% | 27.80% | 0.29% | 0.00% | NA |
| All Japonica | 1512 | 76.00% | 24.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 0.70% | 98.90% | 0.37% | 0.00% | NA |
| Indica I | 595 | 96.60% | 3.00% | 0.34% | 0.00% | NA |
| Indica II | 465 | 76.10% | 23.40% | 0.43% | 0.00% | NA |
| Indica III | 913 | 52.90% | 46.90% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 72.60% | 27.10% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 95.20% | 4.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 50.80% | 49.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 67.60% | 32.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 49.00% | 51.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 64.40% | 32.20% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1007457578 | C -> A | LOC_Os10g13710.1 | downstream_gene_variant ; 4867.0bp to feature; MODIFIER | silent_mutation | Average:44.604; most accessible tissue: Zhenshan97 flag leaf, score: 66.824 | N | N | N | N |
| vg1007457578 | C -> A | LOC_Os10g13730.1 | downstream_gene_variant ; 188.0bp to feature; MODIFIER | silent_mutation | Average:44.604; most accessible tissue: Zhenshan97 flag leaf, score: 66.824 | N | N | N | N |
| vg1007457578 | C -> A | LOC_Os10g13710-LOC_Os10g13730 | intergenic_region ; MODIFIER | silent_mutation | Average:44.604; most accessible tissue: Zhenshan97 flag leaf, score: 66.824 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1007457578 | 4.30E-07 | NA | mr1026 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007457578 | 1.49E-07 | 1.64E-23 | mr1026 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007457578 | NA | 5.66E-15 | mr1113 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007457578 | NA | 8.70E-10 | mr1113 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007457578 | 3.18E-07 | 8.58E-11 | mr1114 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007457578 | NA | 2.63E-16 | mr1116 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007457578 | 5.26E-06 | 2.15E-09 | mr1116 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007457578 | 2.20E-09 | NA | mr1118 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007457578 | 9.07E-10 | 2.20E-26 | mr1118 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007457578 | NA | 1.14E-06 | mr1118 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007457578 | 7.88E-06 | 5.90E-09 | mr1119 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007457578 | 2.03E-07 | 3.05E-10 | mr1120 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007457578 | NA | 2.57E-06 | mr1123 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007457578 | 6.11E-07 | NA | mr1161 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007457578 | 2.89E-07 | 2.45E-22 | mr1161 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007457578 | NA | 2.99E-06 | mr1242 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007457578 | 4.47E-06 | 5.03E-09 | mr1247 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007457578 | NA | 4.06E-07 | mr1261 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007457578 | 9.81E-12 | NA | mr1495 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007457578 | 1.04E-11 | 2.40E-31 | mr1495 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007457578 | NA | 2.90E-09 | mr1495 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007457578 | NA | 1.79E-09 | mr1496 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007457578 | NA | 1.07E-06 | mr1503 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007457578 | 3.46E-09 | 7.76E-10 | mr1794 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007457578 | 2.46E-07 | 1.16E-13 | mr1794 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007457578 | NA | 2.08E-06 | mr1794 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007457578 | NA | 1.23E-06 | mr1892 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007457578 | NA | 3.05E-06 | mr1917 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007457578 | NA | 3.71E-07 | mr1936 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007457578 | 6.36E-06 | 5.14E-11 | mr1113_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007457578 | NA | 1.49E-16 | mr1114_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007457578 | 2.57E-06 | 3.23E-11 | mr1114_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007457578 | NA | 2.95E-09 | mr1117_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007457578 | 1.06E-07 | NA | mr1118_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007457578 | 2.95E-08 | 5.98E-34 | mr1118_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007457578 | NA | 6.60E-08 | mr1118_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007457578 | NA | 7.10E-09 | mr1119_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007457578 | 8.64E-07 | 1.51E-14 | mr1120_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007457578 | NA | 8.68E-07 | mr1123_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007457578 | NA | 4.36E-06 | mr1123_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007457578 | 1.07E-07 | NA | mr1161_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007457578 | 8.34E-07 | 4.70E-25 | mr1161_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007457578 | NA | 2.20E-07 | mr1233_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007457578 | 3.25E-06 | 2.39E-12 | mr1247_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007457578 | 4.95E-08 | 1.67E-12 | mr1258_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007457578 | 2.04E-06 | 3.53E-07 | mr1258_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007457578 | 8.97E-10 | NA | mr1495_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007457578 | 4.80E-08 | 9.57E-34 | mr1495_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007457578 | NA | 3.75E-13 | mr1495_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007457578 | NA | 6.62E-10 | mr1496_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007457578 | NA | 4.01E-07 | mr1531_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007457578 | 3.57E-06 | NA | mr1794_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007457578 | NA | 2.18E-15 | mr1794_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007457578 | NA | 1.08E-06 | mr1892_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007457578 | NA | 1.61E-09 | mr1936_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007457578 | NA | 2.73E-07 | mr1936_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007457578 | NA | 7.65E-17 | mr1961_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007457578 | 7.17E-06 | 1.02E-09 | mr1961_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |