RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg1007457578:

Variant ID: vg1007457578 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 7457578
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.81, A: 0.17, others allele: 0.00, population size: 182. )

Flanking Sequence (100 bp) in Reference Genome:

CTGAAAATTTCATTTGAAGAATTTCCTCAAAATTCAAAGATCCTAAATGCAATTTTGAAATTCAAACATGTATTGATGCAAAAATTTCAATTGTGGAAAA[C/A]
AAATATGCAGATACATACCAATTTACCTGTTGGCGAAGGTTGCGTCATTTTAAGTCCGACGTGCAAGACCGTACCTCCTTCCAGTTTAGTTCGCGGATTT

Reverse complement sequence

AAATCCGCGAACTAAACTGGAAGGAGGTACGGTCTTGCACGTCGGACTTAAAATGACGCAACCTTCGCCAACAGGTAAATTGGTATGTATCTGCATATTT[G/T]
TTTTCCACAATTGAAATTTTTGCATCAATACATGTTTGAATTTCAAAATTGCATTTAGGATCTTTGAATTTTGAGGAAATTCTTCAAATGAAATTTTCAG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.50%	31.20%	0.25%	0.00%	NA
All Indica	2759	71.90%	27.80%	0.29%	0.00%	NA
All Japonica	1512	76.00%	24.00%	0.00%	0.00%	NA
Aus	269	0.70%	98.90%	0.37%	0.00%	NA
Indica I	595	96.60%	3.00%	0.34%	0.00%	NA
Indica II	465	76.10%	23.40%	0.43%	0.00%	NA
Indica III	913	52.90%	46.90%	0.22%	0.00%	NA
Indica Intermediate	786	72.60%	27.10%	0.25%	0.00%	NA
Temperate Japonica	767	95.20%	4.80%	0.00%	0.00%	NA
Tropical Japonica	504	50.80%	49.20%	0.00%	0.00%	NA
Japonica Intermediate	241	67.60%	32.40%	0.00%	0.00%	NA
VI/Aromatic	96	49.00%	51.00%	0.00%	0.00%	NA
Intermediate	90	64.40%	32.20%	3.33%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1007457578	C -> A	LOC_Os10g13710.1	downstream_gene_variant ; 4867.0bp to feature; MODIFIER	silent_mutation	Average:44.604; most accessible tissue: Zhenshan97 flag leaf, score: 66.824	N	N	N	N
vg1007457578	C -> A	LOC_Os10g13730.1	downstream_gene_variant ; 188.0bp to feature; MODIFIER	silent_mutation	Average:44.604; most accessible tissue: Zhenshan97 flag leaf, score: 66.824	N	N	N	N
vg1007457578	C -> A	LOC_Os10g13710-LOC_Os10g13730	intergenic_region ; MODIFIER	silent_mutation	Average:44.604; most accessible tissue: Zhenshan97 flag leaf, score: 66.824	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1007457578	4.30E-07	NA	mr1026	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007457578	1.49E-07	1.64E-23	mr1026	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007457578	NA	5.66E-15	mr1113	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007457578	NA	8.70E-10	mr1113	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007457578	3.18E-07	8.58E-11	mr1114	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007457578	NA	2.63E-16	mr1116	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007457578	5.26E-06	2.15E-09	mr1116	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007457578	2.20E-09	NA	mr1118	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007457578	9.07E-10	2.20E-26	mr1118	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007457578	NA	1.14E-06	mr1118	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 58 entries

Previous1 2 3 4 5 6Next

Search for Variation information by Variation ID:

Detailed information for vg1007457578:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact