\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1007456082:

Variant ID: vg1007456082 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 7456082
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.65, C: 0.34, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


CATTTTGCCATTTTGTACATTCCTTGCCATTATGTGTGTCTCCCTGTATGTTCCACATGCACAAGATTCTTCTATGGTTTGCAGGGGAATGGTTAGTTCA[T/C]
GATAGTTGTACAAATGATACCCCGCATTTGGCAACGGGATTTCATTTGTACAATCGGGGAAAAAGTATATCAAAGATCCATCTACTCCATGTTTAAGAAT

Reverse complement sequence

ATTCTTAAACATGGAGTAGATGGATCTTTGATATACTTTTTCCCCGATTGTACAAATGAAATCCCGTTGCCAAATGCGGGGTATCATTTGTACAACTATC[A/G]
TGAACTAACCATTCCCCTGCAAACCATAGAAGAATCTTGTGCATGTGGAACATACAGGGAGACACACATAATGGCAAGGAATGTACAAAATGGCAAAATG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.30% 34.00% 0.13% 0.57% NA
All Indica  2759 64.00% 35.20% 0.07% 0.76% NA
All Japonica  1512 62.40% 37.20% 0.13% 0.26% NA
Aus  269 99.60% 0.00% 0.00% 0.37% NA
Indica I  595 13.60% 85.70% 0.00% 0.67% NA
Indica II  465 83.20% 15.30% 0.22% 1.29% NA
Indica III  913 82.80% 16.60% 0.11% 0.44% NA
Indica Intermediate  786 69.00% 30.20% 0.00% 0.89% NA
Temperate Japonica  767 58.30% 41.50% 0.13% 0.13% NA
Tropical Japonica  504 58.10% 41.10% 0.20% 0.60% NA
Japonica Intermediate  241 84.60% 15.40% 0.00% 0.00% NA
VI/Aromatic  96 52.10% 47.90% 0.00% 0.00% NA
Intermediate  90 63.30% 33.30% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1007456082 T -> C LOC_Os10g13710.1 downstream_gene_variant ; 3371.0bp to feature; MODIFIER silent_mutation Average:38.935; most accessible tissue: Zhenshan97 young leaf, score: 55.899 N N N N
vg1007456082 T -> C LOC_Os10g13730.1 downstream_gene_variant ; 1684.0bp to feature; MODIFIER silent_mutation Average:38.935; most accessible tissue: Zhenshan97 young leaf, score: 55.899 N N N N
vg1007456082 T -> C LOC_Os10g13710-LOC_Os10g13730 intergenic_region ; MODIFIER silent_mutation Average:38.935; most accessible tissue: Zhenshan97 young leaf, score: 55.899 N N N N
vg1007456082 T -> DEL N N silent_mutation Average:38.935; most accessible tissue: Zhenshan97 young leaf, score: 55.899 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1007456082 8.94E-09 NA mr1026 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007456082 1.20E-14 3.44E-27 mr1026 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007456082 NA 5.29E-08 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007456082 NA 6.84E-08 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007456082 NA 4.00E-06 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007456082 4.82E-06 NA mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007456082 4.80E-10 3.16E-22 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007456082 6.29E-06 1.07E-08 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007456082 7.37E-09 NA mr1161 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007456082 3.89E-15 3.96E-26 mr1161 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007456082 NA 7.16E-06 mr1242 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007456082 NA 5.08E-06 mr1247 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007456082 NA 3.06E-07 mr1261 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007456082 1.32E-07 NA mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007456082 7.25E-10 5.61E-27 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007456082 NA 2.59E-11 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007456082 1.61E-07 7.04E-12 mr1794 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007456082 5.98E-06 1.78E-12 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007456082 NA 4.46E-06 mr1922 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007456082 6.75E-06 5.00E-08 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007456082 NA 7.06E-08 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007456082 1.03E-07 2.65E-26 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007456082 1.03E-06 7.54E-11 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007456082 NA 4.11E-06 mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007456082 3.82E-07 1.38E-20 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007456082 NA 5.05E-06 mr1233_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007456082 6.20E-06 2.97E-08 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007456082 1.22E-06 7.44E-28 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007456082 NA 1.12E-09 mr1496_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007456082 NA 8.02E-07 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007456082 NA 3.36E-13 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007456082 NA 2.13E-13 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007456082 NA 2.10E-08 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007456082 NA 9.13E-06 mr1961_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251