RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg1007456082:

Variant ID: vg1007456082 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 7456082
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.65, C: 0.34, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:

CATTTTGCCATTTTGTACATTCCTTGCCATTATGTGTGTCTCCCTGTATGTTCCACATGCACAAGATTCTTCTATGGTTTGCAGGGGAATGGTTAGTTCA[T/C]
GATAGTTGTACAAATGATACCCCGCATTTGGCAACGGGATTTCATTTGTACAATCGGGGAAAAAGTATATCAAAGATCCATCTACTCCATGTTTAAGAAT

Reverse complement sequence

ATTCTTAAACATGGAGTAGATGGATCTTTGATATACTTTTTCCCCGATTGTACAAATGAAATCCCGTTGCCAAATGCGGGGTATCATTTGTACAACTATC[A/G]
TGAACTAACCATTCCCCTGCAAACCATAGAAGAATCTTGTGCATGTGGAACATACAGGGAGACACACATAATGGCAAGGAATGTACAAAATGGCAAAATG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.30%	34.00%	0.13%	0.57%	NA
All Indica	2759	64.00%	35.20%	0.07%	0.76%	NA
All Japonica	1512	62.40%	37.20%	0.13%	0.26%	NA
Aus	269	99.60%	0.00%	0.00%	0.37%	NA
Indica I	595	13.60%	85.70%	0.00%	0.67%	NA
Indica II	465	83.20%	15.30%	0.22%	1.29%	NA
Indica III	913	82.80%	16.60%	0.11%	0.44%	NA
Indica Intermediate	786	69.00%	30.20%	0.00%	0.89%	NA
Temperate Japonica	767	58.30%	41.50%	0.13%	0.13%	NA
Tropical Japonica	504	58.10%	41.10%	0.20%	0.60%	NA
Japonica Intermediate	241	84.60%	15.40%	0.00%	0.00%	NA
VI/Aromatic	96	52.10%	47.90%	0.00%	0.00%	NA
Intermediate	90	63.30%	33.30%	2.22%	1.11%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1007456082	T -> C	LOC_Os10g13710.1	downstream_gene_variant ; 3371.0bp to feature; MODIFIER	silent_mutation	Average:38.935; most accessible tissue: Zhenshan97 young leaf, score: 55.899	N	N	N	N
vg1007456082	T -> C	LOC_Os10g13730.1	downstream_gene_variant ; 1684.0bp to feature; MODIFIER	silent_mutation	Average:38.935; most accessible tissue: Zhenshan97 young leaf, score: 55.899	N	N	N	N
vg1007456082	T -> C	LOC_Os10g13710-LOC_Os10g13730	intergenic_region ; MODIFIER	silent_mutation	Average:38.935; most accessible tissue: Zhenshan97 young leaf, score: 55.899	N	N	N	N
vg1007456082	T -> DEL	N	N	silent_mutation	Average:38.935; most accessible tissue: Zhenshan97 young leaf, score: 55.899	N	N	N	N

Showing 1 to 4 of 4 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1007456082	8.94E-09	NA	mr1026	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007456082	1.20E-14	3.44E-27	mr1026	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007456082	NA	5.29E-08	mr1113	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007456082	NA	6.84E-08	mr1114	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007456082	NA	4.00E-06	mr1116	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007456082	4.82E-06	NA	mr1118	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007456082	4.80E-10	3.16E-22	mr1118	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007456082	6.29E-06	1.07E-08	mr1120	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007456082	7.37E-09	NA	mr1161	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007456082	3.89E-15	3.96E-26	mr1161	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 34 entries

Previous1 2 3 4Next

Search for Variation information by Variation ID:

Detailed information for vg1007456082:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact