Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1007353693:

Variant ID: vg1007353693 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 7353693
Reference Allele: T	Alternative Allele: G,C
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:

GTGGTGGGTGTGTCCCCTCTCCTCCTAGGGGACCTTGTATTTATACCCATAGGTATCCCCTTGTCCAAGTAGAACTAAGGAAACCAATATAGATACAATC[T/G,C]
GAGTAGTCCTTGTCGTTTCCATGTAGAACTCTGGTTGTCTTTCCTTATCCGTAACTCCCTCCATATCCGAAGTCAGTTCCCGTATAAGACATGGTATGTG

Reverse complement sequence

CACATACCATGTCTTATACGGGAACTGACTTCGGATATGGAGGGAGTTACGGATAAGGAAAGACAACCAGAGTTCTACATGGAAACGACAAGGACTACTC[A/C,G]
GATTGTATCTATATTGGTTTCCTTAGTTCTACTTGGACAAGGGGATACCTATGGGTATAAATACAAGGTCCCCTAGGAGGAGAGGGGACACACCCACCAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.80%	8.80%	0.78%	4.55%	C: 0.02%
All Indica	2759	77.30%	14.90%	1.12%	6.63%	NA
All Japonica	1512	99.70%	0.10%	0.13%	0.07%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.70%	1.20%	0.17%	0.00%	NA
Indica II	465	78.50%	15.10%	1.29%	5.16%	NA
Indica III	913	60.10%	25.40%	0.55%	13.91%	NA
Indica Intermediate	786	80.50%	13.00%	2.42%	4.07%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.20%	0.20%	0.00%	NA
Japonica Intermediate	241	99.20%	0.00%	0.41%	0.41%	NA
VI/Aromatic	96	69.80%	1.00%	1.04%	28.12%	NA
Intermediate	90	87.80%	3.30%	3.33%	4.44%	C: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1007353693	T -> C	LOC_Os10g13580.1	upstream_gene_variant ; 755.0bp to feature; MODIFIER	silent_mutation	Average:58.412; most accessible tissue: Minghui63 flag leaf, score: 82.289	N	N	N	N
vg1007353693	T -> C	LOC_Os10g13570.1	downstream_gene_variant ; 3397.0bp to feature; MODIFIER	silent_mutation	Average:58.412; most accessible tissue: Minghui63 flag leaf, score: 82.289	N	N	N	N
vg1007353693	T -> C	LOC_Os10g13570-LOC_Os10g13580	intergenic_region ; MODIFIER	silent_mutation	Average:58.412; most accessible tissue: Minghui63 flag leaf, score: 82.289	N	N	N	N
vg1007353693	T -> G	LOC_Os10g13580.1	upstream_gene_variant ; 755.0bp to feature; MODIFIER	silent_mutation	Average:58.412; most accessible tissue: Minghui63 flag leaf, score: 82.289	N	N	N	N
vg1007353693	T -> G	LOC_Os10g13570.1	downstream_gene_variant ; 3397.0bp to feature; MODIFIER	silent_mutation	Average:58.412; most accessible tissue: Minghui63 flag leaf, score: 82.289	N	N	N	N
vg1007353693	T -> G	LOC_Os10g13570-LOC_Os10g13580	intergenic_region ; MODIFIER	silent_mutation	Average:58.412; most accessible tissue: Minghui63 flag leaf, score: 82.289	N	N	N	N
vg1007353693	T -> DEL	N	N	silent_mutation	Average:58.412; most accessible tissue: Minghui63 flag leaf, score: 82.289	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1007353693	NA	2.92E-07	Grain_thickness	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1007353693	NA	6.19E-10	mr1026	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007353693	2.49E-07	6.20E-12	mr1113	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007353693	9.68E-07	1.33E-10	mr1114	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007353693	NA	5.30E-10	mr1116	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007353693	NA	7.18E-06	mr1117	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007353693	3.50E-08	6.25E-18	mr1118	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007353693	NA	5.60E-09	mr1119	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007353693	NA	2.17E-07	mr1120	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007353693	NA	1.12E-09	mr1161	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007353693	NA	6.91E-16	mr1183	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007353693	NA	2.05E-09	mr1183	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007353693	2.66E-06	4.31E-10	mr1247	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007353693	3.11E-06	NA	mr1495	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007353693	3.00E-09	5.30E-22	mr1495	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007353693	NA	8.29E-15	mr1503	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007353693	NA	1.33E-08	mr1503	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007353693	2.53E-06	3.74E-15	mr1794	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007353693	1.20E-06	1.87E-11	mr1794	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007353693	NA	3.69E-08	mr1842	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007353693	NA	1.04E-07	mr1917	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007353693	NA	9.90E-06	mr1936	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007353693	2.92E-06	5.89E-12	mr1113_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007353693	1.62E-06	6.38E-13	mr1114_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007353693	NA	1.16E-09	mr1117_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007353693	6.33E-10	3.25E-20	mr1118_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007353693	NA	5.96E-09	mr1119_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007353693	NA	1.97E-11	mr1120_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007353693	NA	1.56E-06	mr1123_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007353693	NA	2.28E-09	mr1161_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007353693	NA	5.70E-08	mr1183_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007353693	NA	4.74E-10	mr1247_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007353693	8.48E-06	NA	mr1258_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007353693	NA	2.45E-07	mr1258_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007353693	4.23E-09	NA	mr1495_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007353693	5.65E-13	4.32E-25	mr1495_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007353693	4.13E-06	1.55E-19	mr1794_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007353693	9.82E-07	9.39E-15	mr1794_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007353693	NA	1.81E-06	mr1807_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007353693	NA	7.83E-08	mr1936_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251